Dendrobium densiflorum

Lindl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Dendrobium

At a glance

Occurrence records92

Data sources12

Biological traits10

DNA specimens31

eDNA detections32

Sources12 archives

Databases and archives Dendrobium densiflorum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility92 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI32 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics31 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Chemical compositionLOTUS · NPASS79 compounds

Occurrence & distributionGBIF92 records

Environmental DNA1 datasets · 2 countries32 detections

DNA & barcodingBOLD · NCBI31 specimens

Genome at a glanceCCDB · GoaT2.4 Gbp

01Narrative

Dendrobium densiflorum Lindl., 1830 è una pianta della famiglia delle Orchidacee. È detta anche "orchidea ananas", in inglese "Pineapple Orchid".

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formpseudobulbous epiphyte or lithophyte

Lifeform raunkiaer detailedlithophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Climatewet tropical

Climberself-supporting

Elevation max2 900 m

Elevation min300 m

Epiphytefacultative

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Epiphyte

Woodinessnon-woody

03Chemical composition79 compounds

Compounds documented for Dendrobium densiflorum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Dolabellane diterpenoids17

Monomeric stilbenes10

Simple coumarins7

Dolastane diterpenoids6

Phenanthrenes4

Documented compounds79 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,2E,4R,7E)-1,7-dimethyl-4-[(2S)-6-methylhept-5-en-2-yl]cyclodeca-2,7-dien-1-ol	present	NPASS
(1R,2S,6R,7S,10S)-3,7-dimethyl-10-[(2R)-6-methylhept-5-en-2-yl]-11-oxatricyclo[5.3.1.02,6]undec-3-ene	present	NPASS
(1R,3aR,4E,6S,9E,12aS)-3a,6,10-trimethyl-1-prop-1-en-2-yl-2,3,6,7,8,11,12,12a-octahydro-1H-cyclopenta[11]annulene	present	NPASS
(1R,3E,7E,11S,12S)-3,7,18-Dolabellatriene	present	NPASS
(1R,3E,7E,11S,12S,14S)-14-Acetoxy-3,7,18-Dolabellatriene	present	NPASS
(1R,3E,7E,11S,12S,14S)-14-Hydroxy-3,7,18-Dolabellatriene	present	NPASS
(1R,3E,7S,8S,11S,12S)-7,8-Epoxy-14-oxo-3,18-dolabelladiene	present	NPASS
(1R,3S,4S,7E,11S,12S,14S)-14-Acetoxy-3,4-epoxy-7,18-dolabelladiene	present	NPASS
(1R,3S,5S,8E,12S,13S)-1,5,9-trimethyl-13-prop-1-en-2-yl-4-oxatricyclo[10.3.0.03,5]pentadec-8-en-15-one	present	NPASS
(1R,3S,5S,8E,12S,13S)-1,5,9-trimethyl-13-prop-1-en-2-yl-4-oxatricyclo[10.3.0.03,5]pentadec-8-ene	present	NPASS

05DNA & barcoding31 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dendrobium densiflorum has left across the world's sequence archives.

At a glance

DNA specimens31

Marker genes4

GenBank sequences10

eDNA detections32

Countries3

The DNA barcodea real sequence read deposited for this species

ITSOP738551.1 ↗250 bp

ACGT

AGCGTTATGTCGCTCCGTGTTAACTCCATCCCATCGATGTATGGGCTGGCGAAGGCTCGGATGTGCAGTGTGGCTCGTCGTGCCCCTTGG …

Dendrobium densiflorum isolate ZG31 internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2★ITS6★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Dendrobium densiflorum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size2 445 000 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Dendrobium densiflorum2.44 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 40 n = 20

Ploidy2× diploid · measured

Chromosome records38–422n range40median40mode11records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 384×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 · CCDB · book-indian_vol2

CCDB · ipcn-api-dl — Cheng, S. J., Z. H. Hu, X. L. Li & R. Y. Chen. 1985. A preliminary study on the chromosomes of Dendrobium in China. Acta Hort. Sin. 12(2): 119–124.

CCDB · ipcn-api-dl — Sau, H. & A. K. Sharma. 1983. Chromosome evolution and affinity of certain genera of Orchidaceae. Cytologia 48: 363–372.

CCDB · book-ipcn75-78 — Sharma 1970

CCDB · book-indian_vol2 — Banerjee, M. & Chaudhuri, M. 1971

2n 404×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl · CCDB · book-indian_vol2 +1

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · ipcn-api-dl — Shekhar, N. & S. P. Vij. 1986. Cytotaxonomic studies in Dendrobium Sw. Pp. 121--135. In S.P. Vij (editor), Biology, Conservation, and Culture of Orchids. New Delhi, for Orchid Society of India, Affiliated East–West Press.

CCDB · book-indian_vol2 — Kosaki, K. & Kamemoto, H. 1961 ; Mehra, P.N. & Sehgal, R.N. 1976

CCDB · kew — Narayan RKJ, Parida A, Vij SP. 1989. DNA variation in Orchidaceae. Nucleus 32: 71-75.

2n 423×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 · CCDB · book-indian_vol2

CCDB · ipcn-api-dl — Sharma, A. K. & Roy. 1968. In A. K. Chatterji, Orchid cytology in India. J. Cytol. Genet. 3: 32–40.

CCDB · book-ipcn75-78 — Chatterji 1976

CCDB · book-indian_vol2 — Chatterji, A.K. 1976

n 201×CCDB · book-ipcn75-78

CCDB · book-ipcn75-78 — Mehra & Sehgal 1976

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type92 records

Wild obs. + sensor31

Museum / vouchered59

Cultivated / captive2

Range

Area of Occupancy AOO200 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 6≤1 km 4≤10 km 2

12 georeferenced · 19 without coordinates

Open the mapobservation + sensor31

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 8

8 georeferenced · 51 without coordinates

Open the institutions mapphysical evidence59

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beijing, CN	18
Guangzhou, CN	17
South Kensington, GB	9
Bronx, US	5
Denver, US	2
Guilin, CN	2
Chengdu, CN	1

7 institutions · 54 of 59 vouchered records shown · 3 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA32 detections

Where the DNA of Dendrobium densiflorum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found32

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 32 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.6 °C 11.3–21.8

Seasonal swing summer↔winter21.5 °C

Max temp (day)21.1 °C 16.8–25.4

Min temp (night)10.7 °C 4.60–16.8

Precipitation117 mm/mo 34.5–200

Air humidity54.4 % 47.4–61.3

Moisture balance-11.5 mm/mo -78.5–55.6

Vapour deficit936 Pa 849–1,022

Wind speed3.10 m/s 2.10–4.20

Cloud cover32.8 % 25.9–39.8

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)