Dendrobium crepidatum

Lindl. & Paxton · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Dendrobium

At a glance

Occurrence records37

Data sources11

Biological traits8

DNA specimens73

eDNA detections72

Sources11 archives

Databases and archives Dendrobium crepidatum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility37 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI72 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics73 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources8 traits

Chemical compositionLOTUS · NPASS35 compounds

Occurrence & distributionGBIF37 records

Environmental DNA1 datasets · 1 countries72 detections

DNA & barcodingBOLD · NCBI73 specimens

Genome at a glanceCCDB2n = 38

01Narrative

玫瑰石斛（学名：），为兰科石斛属下的一个植物种。

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction2

Life formpseudobulbous epiphyte or lithophyte

Lifeform raunkiaer detailedlithophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatesubtropical

Climberself-supporting

Epiphytefacultative

Growth formepiphyte

Woodinessnon-woody

03Chemical composition35 compounds

Compounds documented for Dendrobium crepidatum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Iridoids monoterpenoids4

Cinnamic acids and derivatives $ Phenylethanoids4

Dibenzylbutyrolactone lignans3

Flavonols3

Indolizidine alkaloids $ Terpenoid alkaloids3

Documented compounds35 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Ursolic Acid	present	NPASS
(-)-Arctigenin	present	NPASS
(-)-Arctiin	present	NPASS
(1S,4aS,7S,7aS)-1-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-4-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxycarbonyl-1,4a,5,6,7,7a-hexahydrocyclopenta[c]pyran-7-carboxylic acid	present	NPASS
(3aR,5aS,5bR,7aR,9S,11aR,11bR,13bS)-9-hydroxy-2,2,5a,5b,8,8,11a-heptamethyl-3,4,5,6,7,7a,9,10,11,11b,12,13b-dodecahydro-1H-cyclopenta[a]chrysene-3a-carboxylic acid	present	NPASS
1-[(1S,4S,5S,6R,8S,9S,10R)-6,9-dihydroxy-6,10-dimethyl-9-phenyl-12-azatricyclo[6.3.1.04,12]dodecan-5-yl]ethanone	present	LOTUS
7-O-methyl 4-O-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl] (1S,4aS,7S,7aS)-1-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-1,4a,5,6,7,7a-hexahydrocyclopenta[c]pyran-4,7-dicarboxylate	present	NPASS
[(2R,3S,4R,5S,6S)-6-[2-(3,4-dihydroxyphenyl)ethoxy]-5-hydroxy-2-(hydroxymethyl)-4-[(2S,3R,4R,5S,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-3-yl] (E)-3-(3,4-dihydroxyphenyl)prop-2-enoate	present	NPASS
AAGCATAPYOEULE-XJMCYTIUSA-N	present	NPASS
Adoxosidic acid	present	NPASS

05DNA & barcoding73 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dendrobium crepidatum has left across the world's sequence archives.

At a glance

DNA specimens73

Marker genes5

GenBank sequences10

eDNA detections72

Countries2

The DNA barcodea real sequence read deposited for this species

ITSPP109052.1 ↗248 bp

ACGT

AGCATTTTGTTGCTCCGTGTCTACTCACACCCATCGATGGATGTGCTGGTGTAGGCTCGGATGTGCATGCTGGCTCGTCGTTCTCCCAAG …

Dendrobium crepidatum voucher ABRC23121802H internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★matK2★rbcL2★ITS6★ITS2

animal barcodeplant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Dendrobium crepidatum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 38 n = 19

Ploidydiploid inferred

Chromosome records38–382n range38median38mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 385×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-ipcn73-74 +1

CCDB · ipcn-api-dl — Cheng, S. J., Z. H. Hu, X. L. Li & R. Y. Chen. 1985. A preliminary study on the chromosomes of Dendrobium in China. Acta Hort. Sin. 12(2): 119–124.

CCDB · book-ipcn67-71 — KAMEMOTO, H . & R. SAGARIK. 1967. Chromosome numbers of Dendrobium species of Thailand. Amer. Orchid Soc. Bull. 36: 889-894.

CCDB · book-ipcn73-74 — HEDGE, S.N., & G. BORAIAH. 1973. Cytotaxonomical studies in the gen Dendrobium sw. Proc. Indian Sci. Congr. Assoc. 60(III): 309.

CCDB · book-indian_vol2 — Jones, K. 1963 ; Kamemoto, H. & Sagarik, R. 1967 ; Hedge, S.N. & Boraiah, G. 1973

CCDB · book-indian_vol2 — Hedge, S.N. & Boraiah, G. 1973

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type37 records

Wild obs. + sensor14

Museum / vouchered23

Range

Area of Occupancy AOO92 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy55% within 1 km

≤100 m 5≤1 km 1≤10 km 5

11 georeferenced · 3 without coordinates

Open the mapobservation + sensor14

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤100 m 1≤1 km 1≤10 km 1

3 georeferenced · 20 without coordinates

Open the institutions mapphysical evidence23

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beijing, CN	6
Durango, MX	2
South Kensington, GB	2
Kunming, CN	1

4 institutions · 11 of 23 vouchered records shown · 11 without an institution code

09Environmental DNA72 detections

Where the DNA of Dendrobium crepidatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found72

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 72 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.0 °C 10.0–10.0

Seasonal swing summer↔winter31.5 °C

Max temp (day)15.7 °C

Min temp (night)3.10 °C

Precipitation13.8 mm/mo

Air humidity45.7 %

Moisture balance-95.2 mm/mo

Vapour deficit827 Pa

Wind speed4.50 m/s

Cloud cover24.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)