Dendrobium chrysotoxum

Lindl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Dendrobium

At a glance

Occurrence records78

Data sources13

Biological traits7

DNA specimens34

eDNA detections34

Sources13 archives

Databases and archives Dendrobium chrysotoxum's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility78 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI34 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics34 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources7 traits

Chemical compositionLOTUS · NPASS84 compounds

Occurrence & distributionGBIF78 records

Environmental DNA1 datasets · 2 countries34 detections

DNA & barcodingBOLD · NCBI34 specimens

Genome at a glanceCCDB · GoaT · NCBI≈1.4 Gbp

01Narrative

Dendrobium chrysotoxum (golden-bow dendrobium or fried-egg orchid) is a widely cultivated species of orchid. It is native to Southeast Asia, growing naturally in Myanmar, Bhutan, Yunnan (China), Manipur, Assam (India), Bangladesh, Andaman Islands, Laos, Nepal, Thailand, and Vietnam.Kew World Checklist of Selected Plant FamiliesFlora of China v 25 p 375, 鼓槌石斛 gu chui shi hu, Dendrobium chrysotoxum Lindley, Edwards’s Bot. Reg. 33: ad t. 19. 1847Hossain, A.B.M. (2002). A Taxonomic report on the genus Dendrobium Sw.. Bangladesh Journal of Plant Taxonomy 9(2): 47-55.Sittisujjatham, S. (2006). Wild Orchid of Thailand 1: 1-495. Amarin.Lucksom, S.Z. (2007). The orchids of Sikkim and North East Himalaya: 1-984. S.Z.Lucksom, India.Pandey, R.P. & Dilwakar, P.G. (2008). An integrated check-list flora of Andaman and Nicobar islands, India. Journal of Economic and Taxonomic Botany 32: 403-500.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction1

Life formpseudobulbous epiphyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatewet tropical

Climberself-supporting

Epiphyteobligatory

Growth formepiphyte

Woodinessnon-woody

03Chemical composition84 compounds

Compounds documented for Dendrobium chrysotoxum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Phenanthrenes14

Monomeric stilbenes11

Stigmastane steroids6

Simple phenolic acids4

Flavanones4

Documented compounds84 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Syringaresinol	present	NPASS
(-)-Syringaresinol	present	NPASS
(1S,2R,3S,3'R,5R,6S,7R,8S,9S,12S)-2,12-dihydroxy-3'-[(1R)-1-hydroxyethyl]-8-methoxy-7-methyl-12-prop-1-en-2-ylspiro[4,10-dioxatetracyclo[7.2.1.02,7.03,5]dodecane-6,5'-oxolane]-2',11-dione	present	NPASS
(4aS,6aS,6aR,6bS,8aS,9R,10S,12aS,14aS,14bS)-10-hydroxy-2,2,4a,6a,6a,8a,9,14a-octamethyl-3,4,6,6b,7,8,9,10,11,12,12a,13,14,14b-tetradecahydro-1H-picen-5-one	present	NPASS
(4R,4aS,6aS,6aS,6bR,8aS,12aS,14aS,14bS)-4,4a,6a,6b,8a,11,11,14a-octamethyl-1,2,4,5,6,6a,7,9,10,12,12a,13,14,14b-tetradecahydropicene-3,8-dione	present	NPASS
(6S,23R)-20-hydroxy-6,23-dimethyl-4-azahexacyclo[12.11.0.02,11.04,9.015,24.018,23]pentacosan-17-one	present	NPASS
(7aR)-6-hydroxy-4,4,7a-trimethyl-6,7-dihydro-5H-1-benzofuran-2-one	present	NPASS
(9R)-4-methoxy-9H-fluorene-2,5,9-triol	present	LOTUS
(R)-naringenin	present	NPASS
(S)-Naringenin	present	NPASS

05DNA & barcoding34 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dendrobium chrysotoxum has left across the world's sequence archives.

At a glance

DNA specimens34

Marker genes4

GenBank sequences10

eDNA detections34

Countries3

The DNA barcodea real sequence read deposited for this species

ITSOP738545.1 ↗248 bp

ACGT

AGCGTTACGTCGCTCCGTGTCCAGCCACCCGTCGATGGATGGGCTGGCGATGGCTCGGATGTGCACAGTGGCTCCTCGTGCCCCTCGGCA …

Dendrobium chrysotoxum isolate ZG25 internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL4★ITS4★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT · NCBI

The complete instruction manual Dendrobium chrysotoxum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈1 368 173 789 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Dendrobium chrysotoxum1.37 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 38 n = 19

Ploidydiploid inferred

Chromosome records38–402n range38median38mode10records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 387×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-indian_vol2

CCDB · ipcn-api-dl — Cheng, S. J., Z. H. Hu, X. L. Li & R. Y. Chen. 1985. A preliminary study on the chromosomes of Dendrobium in China. Acta Hort. Sin. 12(2): 119–124.

CCDB · ipcn-api-dl — Hashimoto, K. 1987. Karyomorphological studies of some 80 taxa of Dendrobium, Orchidaceae. Bull. Hiroshima Bot. Gard. 9: 1–186.

CCDB · ipcn-api-dl — Vijayakumar, N. & D. Subramanian. 1994. Karyomorphological studies of Orchidaceae from Tamilnadu. Cell Chromosome Res. 17(1): 40–47.

CCDB · ipcn-api-dl — Hashimoto, K. 1981. Chromosome count in Dendrobium I. 87 species. Bull. Hiroshima Bot. Gard. 4: 63–80.

CCDB · book-ipcn67-71 — KAMEMOTO, H . & R. SAGARIK. 1967. Chromosome numbers of Dendrobium species of Thailand. Amer. Orchid Soc. Bull. 36: 889-894.

CCDB · book-ipcn67-71 — WILFRET, G.J., & H. KAMEMOTO. 1971. Genome and karyotype relationship in the genus Dendrobium (Orchidaceael II. Karyotype relationships. Cytologia 36: 604-613.

CCDB · book-indian_vol2 — Jones, K. 1963 ; Kosaki, K. & Kamemoto, H. 1961 ; Kamemoto, H. & Sagarik, R. 1967 ; Wilfret, G.J. & Kamernoto, H. 1971 ; Vij, S.P. & Mehra, P.N. 1976

2n 403×CCDB · book-indian_vol2 · CCDB · book-atlas-flowering-plants · CCDB · Cave1963

CCDB · book-indian_vol2 — Hoffmann, K.M. 1929, 1930 ; Ito, I. & Matsuura, S. 1957 (Chardard, R. 1963) ; Chardard, R. 1963

CCDB · book-atlas-flowering-plants

CCDB · Cave1963 — Chardard 1963

n 191×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Shekhar, N. & S. P. Vij. 1986. Cytotaxonomic studies in Dendrobium Sw. Pp. 121--135. In S.P. Vij (editor), Biology, Conservation, and Culture of Orchids. New Delhi, for Orchid Society of India, Affiliated East–West Press.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness91.6% BUSCO

07Deep time~7.3 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin7.3 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type78 records

Wild obs. + sensor51

Museum / vouchered26

Cultivated / captive1

Range

Area of Occupancy AOO244 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy68% within 1 km

≤100 m 15≤1 km 10≤10 km 4>10 km 8

37 georeferenced · 14 without coordinates

Open the mapobservation + sensor51

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 25 without coordinates

Open the institutions mapphysical evidence26

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beijing, CN	9
Kunming, CN	2
Harvard Universitylocation not on record	2
Museo Nacional de Costa Rica (MNCR)location not on record	1
Denver, US	1
Saint Louis, US	1

6 institutions · 16 of 26 vouchered records shown · 7 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA34 detections

Where the DNA of Dendrobium chrysotoxum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found34

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 34 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.9 °C 17.9–26.9

Seasonal swing summer↔winter9.80 °C

Max temp (day)23.7 °C 23.4–30.3

Min temp (night)18.9 °C 11.7–22.6

Precipitation137 mm/mo 54.9–621

Air humidity59.8 % 53.4–68.1

Moisture balance-8.90 mm/mo -65.9–504

Vapour deficit928 Pa 810–1,404

Wind speed2.20 m/s 1.50–3.10

Cloud cover38.6 % 33.4–41.0

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)