Dendrobium chrysanthum

Wall. ex Lindl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Dendrobium

At a glance

Occurrence records160

Data sources11

Biological traits10

DNA specimens57

eDNA detections56

Sources11 archives

Databases and archives Dendrobium chrysanthum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility160 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI56 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics57 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Chemical compositionLOTUS · NPASS110 compounds

Occurrence & distributionGBIF160 records

Environmental DNA1 datasets · 2 countries56 detections

DNA & barcodingBOLD · NCBI57 specimens

Genome at a glanceCCDB2n = 38

01Narrative

束花石斛（学名：）为兰科石斛属下的一个种。

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formpseudobulbous epiphyte or lithophyte

Lifeform raunkiaer detailedlithophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Climatewet tropical

Climberself-supporting

Elevation max2 500 m

Elevation min900 m

Epiphytefacultative

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Epiphyte

Woodinessnon-woody

03Chemical composition110 compounds

Compounds documented for Dendrobium chrysanthum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Phenanthrenes11

Monomeric stilbenes8

Fatty aldehydes7

Stigmastane steroids5

Fatty alcohols4

Documented compounds110 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Cyclosativene, 99%	present	NPASS
(+)-Syringaresinol	present	NPASS
(-)-Syringaresinol	present	NPASS
(3S)-7,7',10'-trihydroxy-4,4'-dimethoxyspiro[2H-cyclopenta[a]naphthalene-3,3'-naphtho[2,1-e][1]benzofuran]-1,2'-dione	present	LOTUS
(7aR)-6-hydroxy-4,4,7a-trimethyl-6,7-dihydro-5H-1-benzofuran-2-one	present	NPASS
(E)-1-[(2S)-2-(2-oxopropyl)pyrrolidin-1-yl]-3-phenylprop-2-en-1-one	present	LOTUS
(E)-2-Heptenal	present	NPASS
(E)-2-Pentenal	present	NPASS
(R)-naringenin	present	NPASS
(S)-alpha-Phellandrene	present	NPASS

05DNA & barcoding57 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dendrobium chrysanthum has left across the world's sequence archives.

At a glance

DNA specimens57

Marker genes5

GenBank sequences10

eDNA detections56

Countries2

The DNA barcodea real sequence read deposited for this species

ITSPP109017.1 ↗245 bp

ACGT

AGCATTTTGTAGCTCCGTGTCTAGTCACCCATCAATGGATGTGCTGGCGAAGGCTCGGATGTGCACGTTGGCCCGTCGTGCCACTCGGTG …

Dendrobium chrysanthum voucher ABRC2312103H internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★matK1★rbcL5★ITS4★ITS2

animal barcodeplant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Dendrobium chrysanthum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 38 n = 19

Ploidydiploid inferred

Chromosome records38–762n range40median38mode11records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 385×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-ipcn75-78 +1

CCDB · ipcn-api-dl — Shekhar, N. & S. P. Vij. 1986. Cytotaxonomic studies in Dendrobium Sw. Pp. 121--135. In S.P. Vij (editor), Biology, Conservation, and Culture of Orchids. New Delhi, for Orchid Society of India, Affiliated East–West Press.

CCDB · ipcn-api-dl — Vijayakumar, N. & D. Subramanian. 1994. Karyomorphological studies of Orchidaceae from Tamilnadu. Cell Chromosome Res. 17(1): 40–47.

CCDB · book-ipcn67-71 — KAMEMOTO, H . & R. SAGARIK. 1967. Chromosome numbers of Dendrobium species of Thailand. Amer. Orchid Soc. Bull. 36: 889-894.

CCDB · book-ipcn75-78 — Vij et al. 1976

CCDB · book-indian_vol2 — Vajrabhaya, T. & Randolph, L.F. 1960; Kosaki, K. & Kamemoto, H. 1961 ; Jones, K. 1963 ; Kamemoto, H. & Sagarik, R. 1967 ; Vij, S.P., Gupta, G.C. & Garg, A.K. 1976 ; Vij, S.P. & Mehra, P.N. 1976

2n 404×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 · CCDB · book-indian_vol2

CCDB · ipcn-api-dl — Mehra, P. N. & S. K. Kashyap. 1989. Cytol. Orchids North-W. Himalayas Pramodh P. Kapur at Raj Bandhu Industrial Co., New Delhi.

CCDB · book-ipcn75-78 — Sharma 1970

CCDB · book-ipcn75-78 — Mehra & Kashyap 1978

CCDB · book-indian_vol2 — Banerjee, M. & Chaudhuri, M. 1971 ; Mehra, P.N. & Sehgal, R.N. 1976 , Mehra, P.N. & Kashyap, S.K. 1978

2n 762×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Cheng, S. J., Z. H. Hu, X. L. Li & R. Y. Chen. 1985. A preliminary study on the chromosomes of Dendrobium in China. Acta Hort. Sin. 12(2): 119–124.

CCDB · ipcn-api-dl — Chen, R. y., W. q. Song, X. l. Li, M. x. Li, G. l. Liang & C. b. Chen. 2003. Chromosome Atlas of Major Economic Plants Genome in China, Vol. 3, Chromosome Atlas of Garden Flowering Plants in China. Science Press, Beijing.

n 202×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78

CCDB · ipcn-api-dl — Sau, H. & A. K. Sharma. 1983. Chromosome evolution and affinity of certain genera of Orchidaceae. Cytologia 48: 363–372.

CCDB · book-ipcn75-78 — Mehra & Sehgal 1976

n 191×CCDB · ipcn-api-dl

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type160 records

Wild obs. + sensor50

Museum / vouchered107

Cultivated / captive3

Range

Area of Occupancy AOO384 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy72% within 1 km

≤100 m 16≤1 km 10≤10 km 5>10 km 5

36 georeferenced · 14 without coordinates

Open the mapobservation + sensor50

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤1 km 2≤10 km 2

4 georeferenced · 103 without coordinates

Open the institutions mapphysical evidence107

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beijing, CN	46
Kunming, CN	14
Saint Louis, US	9
South Kensington, GB	8
Guilin, CN	7
Harvard Universitylocation not on record	5
Bronx, US	2
Guangzhou, CN	2
Moscow State Universitylocation not on record	1
Department of Plant Resources, National Herbarium and Plant Laboratorieslocation not on record	1
Edinburgh, GB	1

11 institutions · 96 of 107 vouchered records shown · 9 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA56 detections

Where the DNA of Dendrobium chrysanthum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found56

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 56 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.9 °C 12.4–23.6

Seasonal swing summer↔winter11.3 °C

Max temp (day)23.7 °C 17.3–29.0

Min temp (night)17.9 °C 6.10–18.7

Precipitation120 mm/mo 35.1–617

Air humidity55.6 % 47.7–67.3

Moisture balance-30.1 mm/mo -82.2–500

Vapour deficit827 Pa 790–1,233

Wind speed2.40 m/s 1.50–4.10

Cloud cover34.3 % 26.2–40.2

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)