Dendrobium bigibbum

Lindl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Dendrobium

At a glance

Occurrence records496

Data sources12

Biological traits13

DNA specimens3

eDNA detections4

Sources12 archives

Databases and archives Dendrobium bigibbum's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility496 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources13 traits

Occurrence & distributionGBIF496 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB · GoaT880 Mbp

01Narrative

Dendrobium bigibbum, commonly known as the Cooktown orchid or mauve butterfly orchid, is an epiphytic or lithophytic orchid in the family Orchidaceae. It has cylindrical pseudobulbs, each with between three and five green or purplish leaves and arching flowering stems with up to twenty, usually lilac-purple flowers. It occurs in tropical North Queensland, Australia and New Guinea.Illustration by Lewis Roberts Flower detail There are four varieties of this orchid, each of which has previously been considered a separate species.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Life cycle & reproduction4

Life formpseudobulbous epiphyte or lithophyte

Life spanperennial

Lifeform raunkiaer detailedlithophyte

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

Woodinessnon-woody

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dendrobium bigibbum has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences9

eDNA detections4

Countries2

The DNA barcodea real sequence read deposited for this species

ITSKP142214.1 ↗663 bpAustralia

ACGT

CATTGTCGAGACCGAAATGCATCGAGCGACTCGGAGAACCCGTCGGATACGCGGCGGCGATTGCCGCCGCAAGATAAAGGGCCATCCCGG …

Dendrobium bigibbum var. superbum isolate PA236 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA and genes, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★rbcLa★ITS7

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Dendrobium bigibbum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size880 200 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Dendrobium bigibbum0.88 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 38 n = 19

Ploidy2× diploid · measured

Chromosome records38–382n range38median38mode8records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 388×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +1

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · ipcn-api-dl — Hashimoto, K. 1987. Karyomorphological studies of some 80 taxa of Dendrobium, Orchidaceae. Bull. Hiroshima Bot. Gard. 9: 1–186.

CCDB · ipcn-api-dl — Hashimoto, K. 1981. Chromosome count in Dendrobium I. 87 species. Bull. Hiroshima Bot. Gard. 4: 63–80.

CCDB · book-ipcn67-71 — WILFRET, G.J., & H. KAMEMOTO. 1971. Genome and karyotype relationship in the genus Dendrobium (Orchidaceael II. Karyotype relationships. Cytologia 36: 604-613.

CCDB · book-ipcn67-71 — TANAKA, R. 1971. Types of resting nuclei in Orchidaceae. Bot. Mag. (Tokyo) 84: 118-122.

CCDB · kew — Jones WE, Kuehnle AR, Arumuganathan K. 1998. Nuclear DNA content of 26 Orchid (Orchidaceae) genera with emphasis on Dendrobium. Annals of Botany 82: 189-194.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type496 records

Wild obs. + sensor105

Museum / vouchered358

Cultivated / captive33

Origin

Native2

Range

Area of Occupancy AOO836 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy4% within 1 km

≤100 m 3≤1 km 1≤10 km 2>10 km 99

105 georeferenced

Open the mapobservation + sensor105

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy1% within 1 km

≤100 m 3≤1 km 2≤10 km 352

357 georeferenced · 1 without coordinates

Open the institutions mapphysical evidence358

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy79% within 1 km

≤100 m 1≤1 km 25≤10 km 7

33 georeferenced

Open the mapnot free-living33

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	163
Smithfield, AU	136
Canberra, AU	38
Museo Entomologico de Leonlocation not on record	13
Bangkok, TH	3
Mount Annan, AU	2
Adelaide, AU	2
Parkville, AU	1

8 institutions · 358 of 358 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA4 detections

Where the DNA of Dendrobium bigibbum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)