Dendrobium barbatulum

Lindl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Dendrobium

At a glance

Occurrence records132

Data sources8

Biological traits6

DNA specimens32

eDNA detections31

Sources8 archives

Databases and archives Dendrobium barbatulum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility132 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI31 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics32 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources6 traits

Occurrence & distributionGBIF132 records

Environmental DNA1 datasets · 0 countries31 detections

DNA & barcodingBOLD · NCBI32 specimens

Genome at a glanceCCDB2n = 38

01Narrative

Dendrobium barbatulum adalah spesies tumbuhan yang tergolong ke dalam famili Orchidaceae. Spesies ini juga merupakan bagian dari ordo Asparagales. Spesies Dendrobium barbatulum sendiri merupakan bagian dari genus Dendrobium. Nama ilmiah dari spesies ini pertama kali diterbitkan oleh Schltr..

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction1

Life formpseudobulbous epiphyte

Diet & foraging1

Parasiteindependent

Habitat & environment4

Climateseasonally dry tropical

Climberself-supporting

Epiphyteobligatory

Growth formepiphyte

05DNA & barcoding32 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dendrobium barbatulum has left across the world's sequence archives.

At a glance

DNA specimens32

Marker genes4

GenBank sequences10

eDNA detections31

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMK169311.1 ↗861 bpIndia · 2016

ACGT

TGGATCGATTTGATGGGGGGGGTTTCCCGGGGGCCCCACTTTTACGAGAAGTCCATTGAACCTTATCATTTAGTGGAGGGAGAGGTGGTA …

Dendrobium barbatulum voucher DS0044 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL4★ITS2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Dendrobium barbatulum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 38 n = 19

Ploidydiploid inferred

Chromosome records38–382n range38median38mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 382×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Jorapur, S. M. & P. A. Kulkarni. 1979. Cytotaxonomy of Habenaria. J. Cytol. Genet. 14: 71–74.

CCDB · ipcn-api-dl — Singh, F. 1981. ln Chromosome number reports LXXII. Taxon 30: 704–705.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type132 records

Wild obs. + sensor128

Museum / vouchered4

Range

Area of Occupancy AOO348 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy53% within 1 km

≤100 m 21≤1 km 25≤10 km 33>10 km 8

87 georeferenced · 41 without coordinates

Open the mapobservation + sensor128

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 2 without coordinates

Open the institutions mapphysical evidence4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
South Kensington, GB	2
Gujarat Biodiversity Gene Banklocation not on record	1

2 institutions · 3 of 4 vouchered records shown · 1 without an institution code

09Environmental DNA31 detections

Where the DNA of Dendrobium barbatulum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found31

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 31 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)