Dendrobium aphyllum

(Roxb.) C.E.C.Fisch. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Dendrobium

At a glance

Occurrence records309

Data sources12

Biological traits12

DNA specimens63

eDNA detections62

Sources12 archives

Databases and archives Dendrobium aphyllum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility309 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI62 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics63 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources12 traits

Chemical compositionLOTUS · NPASS17 compounds

Occurrence & distributionGBIF309 records

Environmental DNA1 datasets · 2 countries62 detections

DNA & barcodingBOLD · NCBI63 specimens

Genome at a glanceCCDB · GoaT3.3 Gbp

01Narrative

Дендробиум безлистный — вид многолетних трявянистых растений семейства Орхидные, или Ятрышниковые (Orchidaceae).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology1

Plant height max1 m

Life cycle & reproduction3

Life formpseudobulbous epiphyte or lithophyte

Life spanperennial

Lifeform raunkiaer detailedlithophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Climatewet tropical

Climberself-supporting

Elevation max2 200 m

Elevation min300 m

Epiphyteobligatory

Growth formherb

⚠ sources differ — GIFT: herb · AusTraits: herb · TRY: Epiphyte

Woodinessnon-woody

03Chemical composition17 compounds

Compounds documented for Dendrobium aphyllum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Monomeric stilbenes6

Phenanthrenes4

Acyclic triterpenoids $ Polypodane triterpenoids1

Simple phenolic acids1

Flavan-3-ols $ Monomeric stilbenes1

Documented compounds17 total

Tissue Source Quantified only

Compound	Amount	Source
(2E)-3-Methyl-5-[(1R,3S)-2,2-dimethyl-3-hydroxy-6-methylenecyclohexyl]-2-pentene-1-ol	present	NPASS
2-succinylbenzoate	present	LOTUS
4-Hydroxy-4-[2-(4-hydroxy-3-methoxyphenyl)ethyl]-2,6-dimethoxycyclohexa-2,5-dien-1-one	present	LOTUS
5-(2-(3-Hydroxy-5-methoxyphenyl)ethyl)-2-methoxyphenol	present	LOTUS
5-[2-(1,3-Benzodioxol-5-yl)ethyl]benzene-1,3-diol	present	LOTUS
Achilleol A	present	NPASS
Batatasin Iii	present	LOTUS
Dihydroresveratrol	present	LOTUS
Flavidin	present	LOTUS
Hircinol	present	LOTUS

05DNA & barcoding63 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dendrobium aphyllum has left across the world's sequence archives.

At a glance

DNA specimens63

Marker genes5

GenBank sequences10

eDNA detections62

Countries3

The DNA barcodea real sequence read deposited for this species

ITSPP109050.1 ↗248 bp

ACGT

TACATTTTATCGCTCCATGCCTAGCCACACATCGATGGATGTATTGGCAAAGGCTCGGATGTGCACGGTGGCTCGTCGTGCCCCTCGGCA …

Dendrobium aphyllum voucher ABRC23121705H internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★matK2★rbcL2★ITS6★ITS2

animal barcodeplant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Dendrobium aphyllum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size3 325 200 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Dendrobium aphyllum3.33 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 38 n = 19

Ploidy2× diploid · measured

Chromosome records38–402n range38median38mode16records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 3813×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl · CCDB · book-ipcn66 +4

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · ipcn-api-dl — JONES, K., K. Y. Lim & P. J. Cribb. 1982. The chromosomes of orchids VII. Dendrobium. Kew Bull. 37: 221–227.

CCDB · ipcn-api-dl — Sau, H. & A. K. Sharma. 1983. Chromosome evolution and affinity of certain genera of Orchidaceae. Cytologia 48: 363–372.

CCDB · ipcn-api-dl — Shekhar, N. & S. P. Vij. 1986. Cytotaxonomic studies in Dendrobium Sw. Pp. 121--135. In S.P. Vij (editor), Biology, Conservation, and Culture of Orchids. New Delhi, for Orchid Society of India, Affiliated East–West Press.

CCDB · ipcn-api-dl — Hashimoto, K. 1987. Karyomorphological studies of some 80 taxa of Dendrobium, Orchidaceae. Bull. Hiroshima Bot. Gard. 9: 1–186.

CCDB · ipcn-api-dl — Zaman, M. A. & P. Sultana. 1984. Cytogenetics of some orchids from Bangladesh. II. Dendrobium pierardii L. Bangladesh J. Bot. 13: 32–35.

CCDB · ipcn-api-dl — Hashimoto, K. 1981. Chromosome count in Dendrobium I. 87 species. Bull. Hiroshima Bot. Gard. 4: 63–80.

CCDB · book-ipcn66 — Sharma & Chatterji 1966

CCDB · book-ipcn67-71 — KAMEMOTO, H . & R. SAGARIK. 1967. Chromosome numbers of Dendrobium species of Thailand. Amer. Orchid Soc. Bull. 36: 889-894.

CCDB · book-ipcn75-78 — Sarkar et al. 1978a

CCDB · book-indian_vol2 — Jones, K. 1963 ; Mehra, P.N. & Kashyap, S.K. 1979; Mehra, P.N. & Sehgal, R.N. 1980

CCDB · book-indian_vol2 — Kosaki, K. 1958 (Chardard, R. 1963) ; Vajrabhaya, T. & Randolph, L.F. 1960; Kamemoto, H. & Sagarik, R, 1967 ; Vij, S.P. & Mehra, P.N. 1976; Sarkar, A.K., Datta, N. & Chatterjee, U. 1978

CCDB · kew — Narayan RKJ, Parida A, Vij SP. 1989. DNA variation in Orchidaceae. Nucleus 32: 71-75.

2n 403×CCDB · book-ipcn75-78 · CCDB · book-indian_vol2

CCDB · book-ipcn75-78 — Roy & Sharma 1972

CCDB · book-ipcn75-78 — Sharma 1970

CCDB · book-indian_vol2 — Banerjee, M. & Chaudhuri, M. 1971 ; Roy, S.C. & Sharma, A.K. 1972

n 197×CCDB · ipcn-api-dl · CCDB · book-ipcn66

CCDB · ipcn-api-dl — Mehra, P. N. & S. K. Kashyap. 1989. Cytol. Orchids North-W. Himalayas Pramodh P. Kapur at Raj Bandhu Industrial Co., New Delhi.

CCDB · ipcn-api-dl — Mehra, P. N. & R. N. Sehgal. 1980. In IOPB chromosome number reports LXVII. Taxon 29: 348–350.

CCDB · ipcn-api-dl — Sau, H. & A. K. Sharma. 1983. Chromosome evolution and affinity of certain genera of Orchidaceae. Cytologia 48: 363–372.

CCDB · ipcn-api-dl — Zaman, M. A. & P. Sultana. 1984. Cytogenetics of some orchids from Bangladesh. II. Dendrobium pierardii L. Bangladesh J. Bot. 13: 32–35.

CCDB · ipcn-api-dl — Hashimoto, K. 1981. Chromosome count in Dendrobium I. 87 species. Bull. Hiroshima Bot. Gard. 4: 63–80.

CCDB · book-ipcn66 — Sharma & Chatterji 1966

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type309 records

Wild obs. + sensor216

Museum / vouchered88

Cultivated / captive5

Range

Area of Occupancy AOO788 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 56≤1 km 41≤10 km 19>10 km 21

137 georeferenced · 79 without coordinates

Open the mapobservation + sensor216

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy60% within 1 km

≤1 km 6≤10 km 4

10 georeferenced · 78 without coordinates

Open the institutions mapphysical evidence88

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 5 records without

Open the mapnot free-living5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beijing, CN	39
Kunming, CN	10
South Kensington, GB	9
Brisbane, AU	4
Saint Louis, US	3
Maringá, BR	1
Guilin, CN	1
O.Phueakkhlailocation not on record	1
Harvard Universitylocation not on record	1
Denver, US	1

10 institutions · 70 of 88 vouchered records shown · 16 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA62 detections

Where the DNA of Dendrobium aphyllum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found62

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 62 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.8 °C 3.70–19.8

Seasonal swing summer↔winter21.4 °C

Max temp (day)15.6 °C 9.20–22.0

Min temp (night)7.30 °C -2.00–16.5

Precipitation372 mm/mo 75.7–668

Air humidity58.2 % 48.6–67.8

Moisture balance294 mm/mo 22.5–565

Vapour deficit576 Pa 413–740

Wind speed2.70 m/s 1.60–3.80

Cloud cover29.2 % 19.2–39.2

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)