Demodex folliculorum

(Simon, 1842) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Trombidiformes/Demodecidae/Demodex

At a glance

Occurrence records92

Data sources7

Biological traits0

DNA specimens197

eDNA detections198

Sources7 archives

Databases and archives Demodex folliculorum's data was compiled from.

WikipediaWikimedia Foundation15 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility92 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI198 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics197 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF92 records

Environmental DNA12 datasets · 10 countries198 detections

DNA & barcodingBOLD197 specimens

01Narrative

Demodex folliculorum is a microscopic mite that can only survive on the skin of humans. Most people have D.folliculorum on their skin. Usually, the mites do not cause any harm, so are considered an example of commensalism rather than parasitism. D.folliculorum-caused disease, though, is known as demodicosis.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding197 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Demodex folliculorum has left across the world's sequence archives.

At a glance

DNA specimens197

BINs1

Marker genes14

eDNA detections198

Countries10

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P604 bp consensus86 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 19 variable positions, in barcode order

21Amostly conserved

105Tmostly conserved

141Amostly conserved

159Amostly conserved

222Gvariable

229Cmostly conserved

243Amostly conserved

279Amostly conserved

303Tmostly conserved

321Amostly conserved

348Tmostly conserved

384Tmostly conserved

441Tmostly conserved

480Amostly conserved

483Cmostly conserved

531Cmostly conserved

534Amostly conserved

546Gvariable

603Amostly conserved

ATATGATCTGGCATAATAGGACTAAGCTTAAGCATAATCATTCGTATAGAATTAAGACAACCTGGCAAAATTTTCCAATCAGACCACACC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.2%

Haplotypes31

BIN1

Most divergent pair3.0%

N.AmericaAsiaOtherEurope

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P18S-3P18S-5PCOIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcoderibosomalmitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_026102 ↗ · 13 protein · 22 tRNA · 2 rRNA

COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND1ND212S ribosomal RNA16S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type92 records

Wild obs. + sensor38

Museum / vouchered54

Range

Area of Occupancy AOO284 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy68% within 1 km

≤100 m 15≤1 km 6>10 km 10

31 georeferenced · 7 without coordinates

Open the mapobservation + sensor38

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy10% within 1 km

≤100 m 1≤10 km 4>10 km 5

10 georeferenced · 44 without coordinates

Open the institutions mapphysical evidence54

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Ohio State University Acarology Laboratory, Columbus, OH (OSAL)location not on record	6
New Haven, US	2
Stockholm, SE	2
DOI/FWS, Kenai National Wildlife Refugelocation not on record	1
Cambridge, US	1
RBINS-Scientific Heritagelocation not on record	1

6 institutions · 13 of 54 vouchered records shown · 41 without an institution code

09Environmental DNA198 detections

Where the DNA of Demodex folliculorum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found198

Studies independent surveys12

Countries10

Verifiable raw sequence linked32

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 198 detections have coordinates

Open the map10 countries0

Palearctic

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

Temperature19.4 °C 1.16–30.1

pH6.52 4.70–8.40

Conductivity57.0 µS/cm 19.0–54,658

Salinity34.6 PSU 32.1–36.0

Dissolved oxygen6.46 mg/L 4.58–7.45

Turbidity7.45 NTU 0.071–17.3

Organic carbon1.58 % 0.05–4.41

Water content10.9 % 0.423–34.1

Nitrate-N4.00 mg/kg 3.00–20.0

Nitrate0.8 µmol/L 0.2–1.00

Phosphorus10.0 mg/kg 2.00–794

Clay26.2 % 2.91–33.5

Sand63.9 % 29.0–97.1

Depth0.2 m 0–5,460

Pelagicair [ENVO:00002005]SoilCoastal waterKurosolLatLon out of rangeSodosolTenosolsChromosols

33 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median-5.00 °C -6.00–21.5

Seasonal swing summer↔winter26.4 °C

Max temp (day)-0.5 °C -2.00–24.5

Min temp (night)-9.90 °C -10.1–19.2

Precipitation63.6 mm/mo 39.0–100

Air humidity61.3 % 56.5–64.0

Moisture balance31.4 mm/mo

Vapour deficit166 Pa 145–1,013

Wind speed4.70 m/s

Cloud cover52.2 % 22.1–55.1

CHELSA 1981–2010, ~9 km grid, at location & month of 165 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)