Demodex canis

Leydig, 1859 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Trombidiformes/Demodecidae/Demodex

At a glance

Occurrence records42

Data sources7

Biological traits0

DNA specimens16

eDNA detections16

Sources7 archives

Databases and archives Demodex canis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility42 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF42 records

Environmental DNA1 datasets · 1 countries16 detections

DNA & barcodingBOLD16 specimens

01Narrative

Demodex canis ist eine schlanke, etwa 250 bis 300 µm lange Milbe, die in den Haarbälgen (Haarfollikel) und Talgdrüsen von Hunden parasitiert. Dort ernährt sie sich von Talg und den natürlich abgestoßenen Zellen. In geringer Zahl ist diese Demodex-Milbe Bestandteil der Hautfauna behaarter Säugetiere. Bei stärkerem Vorkommen oder bei Schwächung des Immunsystems verursacht sie die Canine Demodikose. Die weiblichen Milben legen Eier, die sich über ein Larven- und Nymphenstadium zu den erwachsenen Milben entwickeln.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Demodex canis has left across the world's sequence archives.

At a glance

DNA specimens16

BINs1

Marker genes3

eDNA detections16

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P604 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 11 variable positions, in barcode order

42Tmostly conserved

50Amostly conserved

220Amostly conserved

255Cmostly conserved

294Avariable

424Cmostly conserved

467Amostly conserved

507Amostly conserved

556Amostly conserved

572Amostly conserved

574Tmostly conserved

ATATGATCAGGTATAATAGGCCTAAGAATAAGAATAATCATTCGAATAGAACTTAGCCAACCAGGAAAAATCTTTCAATCAGATCAAACC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.64%

Haplotypes5

BIN1

Most divergent pair0.99%

Asia

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type42 records

Wild obs. + sensor24

Museum / vouchered18

Range

Area of Occupancy AOO92 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 6≤1 km 6≤10 km 1>10 km 2

15 georeferenced · 9 without coordinates

Open the mapobservation + sensor24

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 18 records without

Open the institutions mapphysical evidence18

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Ohio State University Acarology Laboratory, Columbus, OH (OSAL)location not on record	18

1 institutions · 18 of 18 vouchered records shown

09Environmental DNA16 detections

Where the DNA of Demodex canis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found16

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 16 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.0 °C 10.0–10.0

Seasonal swing summer↔winter31.5 °C

Max temp (day)15.7 °C

Min temp (night)3.10 °C

Precipitation13.8 mm/mo

Air humidity45.7 %

Moisture balance-95.2 mm/mo

Vapour deficit827 Pa

Wind speed4.50 m/s

Cloud cover24.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)