Demodex brevis

Akbulatova, 1963 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Trombidiformes/Demodecidae/Demodex

At a glance

Occurrence records19

Data sources7

Biological traits0

DNA specimens40

eDNA detections41

Sources7 archives

Databases and archives Demodex brevis's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility19 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI41 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics40 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF19 records

Environmental DNA6 datasets · 4 countries41 detections

DNA & barcodingBOLD40 specimens

01Narrative

Demodex brevis is one of the two species of face mite that inhabit humans (the other being Demodex folliculorum). They are very similar to Demodex folliculorum, with just a few differences. They are usually found in the sebaceous glands of the human body. The same way that D. folliculorum reproduces in the follicles, D. brevis reproduces in the sebaceous glands. Under normal conditions they are not harmful, and are considered to be commensals (the mite benefits but there is no harm or benefit to the host) rather than parasites (where the host is harmed) or mutualistic organisms (where the host is benefitted). During a severe infestation, though, there may be adverse effects on the host, such as demodicosis.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding40 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Demodex brevis has left across the world's sequence archives.

At a glance

DNA specimens40

BINs1

Marker genes15

eDNA detections41

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P604 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 20 variable positions, in barcode order

74Tmostly conserved

83Amostly conserved

135Tmostly conserved

136Amostly conserved

148Amostly conserved

277Amostly conserved

298Gmostly conserved

335Tmostly conserved

348Cmostly conserved

387Tmostly conserved

388Gmostly conserved

419Amostly conserved

453Amostly conserved

455Gmostly conserved

518Tmostly conserved

519Amostly conserved

580Amostly conserved

602Gmostly conserved

603Amostly conserved

604Gmostly conserved

CTTTGATCTGCAATACTAGGTCTAAGCCTAAGAATAATCATCCGAATAGAATTAAGTCAACCAGGTAAAATCATCCAATCAGACCAACTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.1%

Haplotypes6

BIN1

Most divergent pair2.0%

AsiaOther

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P★ITS118S-3P18S-5PCOIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcodefungal barcoderibosomalmitochondrial

08Occurrence & distribution

Record type19 records

Wild obs. + sensor12

Museum / vouchered7

Range

Area of Occupancy AOO68 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy40% within 1 km

≤100 m 2≤1 km 2>10 km 6

10 georeferenced · 2 without coordinates

Open the mapobservation + sensor12

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 4>10 km 1

5 georeferenced · 2 without coordinates

Open the institutions mapphysical evidence7

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Stockholm, SE	2

1 institutions · 2 of 7 vouchered records shown · 5 without an institution code

09Environmental DNA41 detections

Where the DNA of Demodex brevis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found41

Studies independent surveys6

Countries4

Verifiable raw sequence linked8

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 41 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.0 °C -5.00–21.0

Seasonal swing summer↔winter26.4 °C

Max temp (day)15.7 °C -0.5–24.4

Min temp (night)3.10 °C -9.90–17.2

Precipitation63.6 mm/mo 13.8–203

Air humidity60.6 % 45.7–65.9

Moisture balance-4.10 mm/mo -95.2–183

Vapour deficit798 Pa 166–962

Wind speed4.50 m/s 2.30–4.80

Cloud cover45.7 % 24.1–54.6

CHELSA 1981–2010, ~9 km grid, at location & month of 17 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)