Delphinium recurvatum

Greene · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ranunculales/Ranunculaceae/Delphinium

At a glance

Occurrence records460

Data sources10

Biological traits13

DNA specimens5

eDNA detections5

Sources10 archives

Databases and archives Delphinium recurvatum's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility460 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF460 records

Environmental DNA1 datasets · 0 countries5 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceCCDB2n = 16

01Narrative

Delphinium recurvatum is a species of larkspur known by the common names Byron larkspur, recurved larkspur, and valley larkspur. It is endemic to California, where most of its historical range is in the Central Valley. The grasslands of the valley have been mostly claimed for development and agriculture, so this species is now uncommon. This wildflower reaches a maximum height of about half a meter. Its deeply lobed leaves are mainly basal, with those located further up the dark purple stem being much smaller. The flowers are generally blue, with the sepals and lower petals darker than the upper petals. The sepals are usually curved back, the trait which gives the plant its name.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass0.338 mg

Seed mass max0.338 mg

Seed mass min0.338 mg

Life cycle & reproduction2

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Delphinium recurvatum has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes1

GenBank sequences8

eDNA detections5

The DNA barcodea real sequence read deposited for this species

ITSAF258723.1 ↗606 bp

ACGT

GTCGAAACCTGCCCAGCAGAGCGACCCGCGAACGAGTGAAAACAAACCGGGACGGATCGGTTGGGGGCGTCCGCCCCCGACCGGCCGTCC …

Delphinium recurvatum variety 37 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete sequence; 5.8S ribosomal RNA gene, complete sequence; internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS8

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Delphinium recurvatum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records16–162n range16median16mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 164×CCDB · eflora · CCDB · book-fedorov · CCDB · DCDB-2016

CCDB · eflora

CCDB · book-fedorov — Lewis H: et aL 1951

CCDB · book-fedorov — Legro 1961

CCDB · DCDB-2016 — Lewis, H., C. Epling, G. A. L. Mehlquist & C. G. Wyckoff. 1951. Chromosome number of californian Delphiniums and their geographical ocurrence. Ann. Missouri Bot. Gard. 38: 101-117.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type460 records

Wild obs. + sensor346

Museum / vouchered114

Range

Area of Occupancy AOO504 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 187≤1 km 36≤10 km 15>10 km 22

260 georeferenced · 86 without coordinates

Open the mapobservation + sensor346

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy37% within 1 km

≤100 m 1≤1 km 24≤10 km 34>10 km 8

67 georeferenced · 47 without coordinates

Open the institutions mapphysical evidence114

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Los Angeles, US	13
Claremont, US	12
CASlocation not on record	10
Davis, US	8
Santa Barbara, US	7
Fredericton Stock Culture Collectionlocation not on record	5
Riverside, US	5
San Luis Obispo, US	5
San Jose, US	3
Angwin, US	3
Bronx, US	2
Northridge, US	2
Canadian Department of Agriculturelocation not on record	2
Arcata, US	1
US	1
Tampa, US	1
Fullerton, US	1
San Diego, US	1
University of Stellenboschlocation not on record	1
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	1
Bloomington, US	1

21 institutions · 85 of 114 vouchered records shown · 29 without an institution code

09Environmental DNA5 detections

Where the DNA of Delphinium recurvatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)