Delphinium patens

Newb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ranunculales/Ranunculaceae/Delphinium

At a glance

Occurrence records1 193

Data sources7

Biological traits9

DNA specimens5

eDNA detections3

Sources7 archives

Databases and archives Delphinium patens's data was compiled from.

GBIFGlobal Biodiversity Information Facility1 193 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF1 193 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceCCDB2n = 16

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Delphinium patens has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes4

GenBank sequences1

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAF258734.1 ↗621 bp

ACGT

GTCGAAACCTGCCCAGCAGAGCGACCCGCGAACGAGTGAAAACAAACCGGGACGGAACGGTTGGGGGCGTCCGCCCCCGATTGGCCGTCC …

Delphinium patens 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete sequence; 5.8S ribosomal RNA gene, complete sequence; internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★matK-like★rbcLa★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Delphinium patens carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records16–162n range16median16mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 164×CCDB · eflora · CCDB · book-fedorov · CCDB · DCDB-2016

CCDB · eflora

CCDB · book-fedorov — Lewis H. et al. 1951

CCDB · book-fedorov — Legro 1961

CCDB · DCDB-2016 — Lewis, H., C. Epling, G. A. L. Mehlquist & C. G. Wyckoff. 1951. Chromosome number of californian Delphiniums and their geographical ocurrence. Ann. Missouri Bot. Gard. 38: 101-117.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 193 records

Wild obs. + sensor1 190

Museum / vouchered3

Range

Area of Occupancy AOO1 456 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 698≤1 km 118≤10 km 42>10 km 38

896 georeferenced · 294 without coordinates

Open the mapobservation + sensor1 190

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤1 km 1≤10 km 1

2 georeferenced · 1 without coordinates

Open the institutions mapphysical evidence3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
EL PASO, US	1
Vancouver, CA	1
Santa Barbara, US	1

3 institutions · 3 of 3 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Delphinium patens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

Forest; scrubBlack Oak/Pine Woodland with Quercus kellogg…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.3 °C 16.3–18.2

Seasonal swing summer↔winter15.4 °C

Max temp (day)25.6 °C 24.3–26.9

Min temp (night)10.2 °C 9.80–10.6

Precipitation5.60 mm/mo 3.80–7.30

Air humidity45.3 % 39.2–51.5

Moisture balance-172 mm/mo -182–-161

Vapour deficit1,100 Pa 914–1,285

Wind speed2.90 m/s 2.80–3.10

Cloud cover21.7 % 19.6–23.8

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Delphinium patens

At a glance

Sources7 archives

Life cycle & reproduction2

Diet & foraging1

Habitat & environment6

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 193 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions3 of 3 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 193 records