Delphinium occidentale

S.Watson ex J.M.Coult. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ranunculales/Ranunculaceae/Delphinium

At a glance

Occurrence records673

Data sources10

Biological traits8

DNA specimens2

eDNA detections1

Sources10 archives

Databases and archives Delphinium occidentale's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility673 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources8 traits

Chemical compositionLOTUS37 compounds

Occurrence & distributionGBIF673 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 16

01Narrative

Delphinium occidentale, the western larkspur, is a perennial plant in the buttercup family (Ranunculaceae) with purple flowers.Great Basin Wildflowers, Laird R. Blackwell, 2006, Morris Book Publishing LLC., It grows along streambanks and moist areas of the Great Basin in Nevada and Utah. There are usually between few and several stems, which can grow up to about 1.83 m. There are racemes of many small flowers at the ends of branches, ranging from dark blue to white. The leaves are large and palmate. The most widespread tall larkspur, it is also very poisonous.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass1.98 mg

Seed mass max2 mg

Seed mass min1.78 mg

Life cycle & reproduction1

Life formperennial

Habitat & environment3

Climatetemperate

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

03Chemical composition37 compounds

Compounds documented for Delphinium occidentale across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Terpenoid alkaloids33

Isoquinoline alkaloids1

Documented compounds37 total

Tissue Source Quantified only

Compound	Amount	Source
(10,16-Dihydroxy-5-methyl-12-methylidene-3-oxo-7-azaheptacyclo[9.6.2.01,8.05,17.07,16.09,14.014,18]nonadecan-19-yl) 2-methylbutanoate	present	LOTUS
(13R,21xi)-Hetisan-2alpha,11alpha,13-triol	present	LOTUS
(1R,5S,8R,9S,10S,11R,14R,16R,17R,18R,19R)-10,16,19-trihydroxy-5-methyl-12-methylidene-7-azaheptacyclo[9.6.2.01,8.05,17.07,16.09,14.014,18]nonadecan-3-one	present	LOTUS
(1S,2R,3R,4S,5R,6S,8R,9S,10S,13S,16S,17R,18S)-11-ethyl-4,6,16,18-tetramethoxy-13-(methoxymethyl)-11-azahexacyclo[7.7.2.12,5.01,10.03,8.013,17]nonadecane-8,9-diol	present	LOTUS
(1S,2R,3R,4S,5R,6S,8R,9S,13S,16S,17R,18S)-11-Ethyl-13-(hydroxymethyl)-4,6,16,18-tetramethoxy-11-azahexacyclo[7.7.2.12,5.01,10.03,8.013,17]nonadecane-8,9-diol	present	LOTUS
(1S,2R,3R,4S,5S,6S,8R,9S,10S,13S,16S,17R,18S)-11-ethyl-6,16,18-trimethoxy-13-(methoxymethyl)-11-azahexacyclo[7.7.2.12,5.01,10.03,8.013,17]nonadecane-4,8,9-triol	present	LOTUS
(1S,2R,3S,4R,5R,6R,8R,9S,13S,16R,17R,18R)-11-ethyl-4,6,18-trimethoxy-13-(methoxymethyl)-11-azahexacyclo[7.7.2.12,5.01,10.03,8.013,17]nonadecane-8,9,16-triol	present	LOTUS
(1S,2R,3S,5R,6S,8R,10S,13S,16S,17R,18S)-11-ethyl-8,9,16-trihydroxy-6,18-dimethoxy-13-(methoxymethyl)-11-azahexacyclo[7.7.2.12,5.01,10.03,8.013,17]nonadecan-4-one	present	LOTUS
(1S,5R,8R,9S,10R,11R,14R,16S,17R,18R,19S)-10,19-dihydroxy-5-methyl-12-methylidene-7-azaheptacyclo[9.6.2.01,8.05,17.07,16.09,14.014,18]nonadecan-3-one	present	LOTUS
13-Methyl-12,12a,13,14-tetrahydro-2H,6H,9H-6a,14-epoxy(1,3)dioxolo(4,5-i)(1,3)dioxolo(5,6)indeno(2,1-c)(2)benzazepine	present	LOTUS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Delphinium occidentale has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLOR822732.1 ↗486 bpUSA · 2020

ACGT

TTGAATTATTATACTCCGGAATATGCACCCAAAGATACTGATACCTTGGCGGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCCGAA …

Delphinium x occidentale voucher YNP_CS89 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★trnL-F

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Delphinium occidentale carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records16–162n range16median16mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 162×CCDB · book-ipcn73-74 · CCDB · DCDB-2016

CCDB · book-ipcn73-74 — CRAWFORD, D.J. & R.C. GARDNER. 1974. Documented plant chromosome numbers 1974: 2. Sida 5: 292-294.

CCDB · DCDB-2016 — Crawford, D. J. & R. C. Gardner. 1974. Documented plant chromosome numbers 1974. II. Sida 5(4): 292-294.

n 82×CCDB · ipcn-api-dl · CCDB · DCDB-2016

CCDB · ipcn-api-dl — Ward, D. E. & R. W. Spellenberg. 1982. In: IOPB chromosome number reports LXXV. Taxon 31: 364.

CCDB · DCDB-2016 — Ward, D. E. & R. W. Spellenberg. 1982. In A. Löve (ed.) IOPB chromosome number reports LXXV. Taxon 31: 364.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type673 records

Wild obs. + sensor389

Museum / vouchered284

Range

Area of Occupancy AOO2 024 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 226≤1 km 31≤10 km 25>10 km 16

298 georeferenced · 91 without coordinates

Open the mapobservation + sensor389

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy56% within 1 km

≤100 m 20≤1 km 62≤10 km 52>10 km 12

146 georeferenced · 138 without coordinates

Open the institutions mapphysical evidence284

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions25 of 36 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Missoula, US	37
Pocatello, US	35
DOI/NPS, Colonial National Historical Parklocation not on record	31
Bozeman, US	29
Pullman, US	27
Provo, US	16
Chongqing Museumlocation not on record	14
Logan, US	13
Riverside, US	8
Claremont, US	7
DOI/NPS, Greenbelt Parklocation not on record	6
Rocky Mountain Biological Laboratorylocation not on record	6
Emporia, US	5
Grand Junction, US	5
Orem, US	5
Denver, US	5
Weber State Universitylocation not on record	4
Eastern Nevada Landscape Coalitionlocation not on record	3
CASlocation not on record	3
Henderson, US	3
WTUlocation not on record	2
Chadron, US	2
Pittsburg, US	2
Albuquerque, US	2
Wuzhou, CN	2
Northridge, US	1
US	1
Bronx, US	1
Saint Louis, US	1
Cslocation not on record	1
Johnson City, US	1
Davenport, US	1
Flagstaff, US	1
Yellowstone National Park Herbariumlocation not on record	1
Bureau of Land Managementlocation not on record	1
Vancouver, CA	1

36 institutions · 283 of 284 vouchered records shown · 1 without an institution code

09Environmental DNA1 detections

Where the DNA of Delphinium occidentale was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

Phleum, POAPRA, old hayfield

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.8 °C 14.8–14.8

Seasonal swing summer↔winter23.9 °C

Max temp (day)21.9 °C

Min temp (night)7.60 °C

Precipitation60.7 mm/mo

Air humidity50.0 %

Moisture balance-88.1 mm/mo

Vapour deficit842 Pa

Wind speed2.70 m/s

Cloud cover23.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)