Delphinium nuttallianum
Pritz. ex Walp. · speciesAt a glance
Occurrence records9 659
Data sources12
Biological traits17
DNA specimens9
eDNA detections5
Sources12 archives
Databases and archives Delphinium nuttallianum's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility9 659 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics9 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements3 literature sources17 traits
Chemical compositionLOTUS · NPASS108 compounds
Occurrence & distributionGBIF9 659 records
Environmental DNA1 datasets · 2 countries5 detections
DNA & barcodingBOLD · NCBI9 specimens
Genome at a glanceCCDB2n = 16
01Narrative
Delphinium nuttallianum est une espèce de plante herbacée pérenne, toxique, de la famille des Ranunculaceae, originaire de l'ouest de l'Amérique du nord.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPTRYGIFT
Size & morphology4
Plant height0.142 m
Seed mass0.418 mg
Seed mass max0.5 mg
Seed mass min0.329 mg
Life cycle & reproduction3
Deciduousnessdeciduous
Life formperennial
Life spanperennial
Diet & foraging1
Parasiteindependent
Habitat & environment6
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Growth formherb
Woodinessnon-woody
Physiology & chemistry3
Leaf dry-matter content (LDMC)171 mg/g
Photosynthetic pathwayC3
Specific leaf area (SLA)16.6 mm²/mg
03Chemical composition108 compounds
Compounds documented for Delphinium nuttallianum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Terpenoid alkaloids45
Anthraquinones and anthrones14
Simple phenolic acids4
Monomeric stilbenes3
Naphthalenes and derivatives3
Documented compounds108 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (10S)-10-[(9R)-4,5-dihydroxy-2-methyl-10-oxo-9H-anthracen-9-yl]-1,3,8-trihydroxy-6-methyl-10H-anthracen-9-one | present | NPASS | |
| (11-Ethyl-8,9-dihydroxy-6,16,18-trimethoxy-4-oxo-11-azahexacyclo[7.7.2.12,5.01,10.03,8.013,17]nonadecan-13-yl)methyl 2-(3-methyl-2,5-dioxopyrrolidin-1-yl)benzoate | present | LOTUS | |
| (1R,2R,3S,5R,6S,8R,9R,10R,13R,16R,17S,18S)-11-ethyl-8,9-dihydroxy-6,16,18-trimethoxy-13-(methoxymethyl)-11-azahexacyclo[7.7.2.12,5.01,10.03,8.013,17]nonadecan-4-one | present | LOTUS | |
| (1R,2R,3S,5R,6S,8R,9R,10R,13R,16S,17S,18S)-11-ethyl-8,9,16-trihydroxy-6,18-dimethoxy-13-(methoxymethyl)-11-azahexacyclo[7.7.2.12,5.01,10.03,8.013,17]nonadecan-4-one | present | LOTUS | |
| (1R,2S,3R,4S,5R,6R,8S,9S,10R,13R,16R,17R)-11-ethyl-4,6-dimethoxy-13-methyl-11-azahexacyclo[7.7.2.12,5.01,10.03,8.013,17]nonadecane-2,8,16-triol | present | LOTUS | |
| (1R,5R,8R,9S,10S,11S,14R,16R,17R,18R)-10,16-dihydroxy-5-methyl-12-methylidene-7-azaheptacyclo[9.6.2.01,8.05,17.07,16.09,14.014,18]nonadecan-3-one | present | LOTUS | |
| (1R,5S,8R,9S,10S,11S,14R,16R,17R,18R)-10,16-dihydroxy-5-methyl-12-methylidene-7-azaheptacyclo[9.6.2.01,8.05,17.07,16.09,14.014,18]nonadecan-3-one | present | LOTUS | |
| (1S,2R,3R,4S,5R,6S,8R,9S,13S,16S,17R,18S)-11-Ethyl-13-(hydroxymethyl)-4,6,16,18-tetramethoxy-11-azahexacyclo[7.7.2.12,5.01,10.03,8.013,17]nonadecane-8,9-diol | present | LOTUS | |
| (1S,2R,3R,4S,5S,6S,8R,10S,13S,16S,17R,18S)-11-ethyl-6,8,18-trimethoxy-13-(methoxymethyl)-11-azahexacyclo[7.7.2.12,5.01,10.03,8.013,17]nonadecane-4,9,16-triol | present | LOTUS | |
| (1S,2R,3R,4S,5S,6S,8R,9R,10S,13S,16S,17R,18S)-11-ethyl-6,8-dimethoxy-13-(methoxymethyl)-11-azahexacyclo[7.7.2.12,5.01,10.03,8.013,17]nonadecane-4,9,16,18-tetrol | present | LOTUS |
05DNA & barcoding9 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Delphinium nuttallianum has left across the world's sequence archives.
At a glance
DNA specimens9
Marker genes6
GenBank sequences6
eDNA detections5
Countries2
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCNCCGAGGCCACTAGGCCGAGGGAACGCCTGCCTGGGCGTCACACACAG …
Delphinium nuttallianum voucher ERM398 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL3★rbcLa★trnL-F★ITS2★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Delphinium nuttallianum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 16 n = 8
Ploidydiploid inferred
Chromosome records16–162n range16median16mode11records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1611×CCDB · book-ipcn67-71 · CCDB · book-ipcn73-74 · CCDB · eflora +2
CCDB · book-ipcn67-71 — HARTMAN, R.L., & D.J. CRAWFORD. 1971. In IOPB chromosome number reports XXXI. Taxon 20: 157-160:-
CCDB · book-ipcn67-71 — LOEVE, A, D. LOEVE, & B.M. KAPOOR. 1971. Cytotaxonomy of a century of Rocky Mountain orophytes. Arctic & Alpine Res. 3: 139-165.
CCDB · book-ipcn73-74 — CRAWFORD, D.J. & R.C. GARDNER. 1974. Documented plant chromosome numbers 1974: 2. Sida 5: 292-294.
CCDB · eflora
CCDB · book-fedorov — Wiens, Halleck 1962
CCDB · DCDB-2016 — Crawford, D. J. & R. C. Gardner. 1974. Documented plant chromosome numbers 1974. II. Sida 5(4): 292-294.
CCDB · DCDB-2016 — Hartman, R. L. & D. J. Crawford. 1971. In A. Löve (ed.) IOPB chromosome number reports XXXI. Taxon 20: 157-160.
CCDB · DCDB-2016 — Loeve, A., D. Loeve & B. M. Kapoor. 1971. Cytotaxonomy of a century of Rocky Mountain orophhytes. Arctic & Alpine Res. 3: 139-165.
CCDB · DCDB-2016 — Wiens, D. E. & D. K. Halleck. 1962. Chromosome numbers in Rocky Mountain plants, I. Bot. Not. 115: 455-464.
CCDB · DCDB-2016 — Lewis, H., C. Epling, G. A. L. Mehlquist & C. G. Wyckoff. 1951. Chromosome number of californian Delphiniums and their geographical ocurrence. Ann. Missouri Bot. Gard. 38: 101-117.
n 86×CCDB · ipcn-api-dl · CCDB · Cave1957 · CCDB · Cave1962 +1
CCDB · ipcn-api-dl — Warnock, M. J. 1995. Documented chromosome reports and supplementary information on previously reported chromosome counts of North American Delphinium. Phytologia 78(2): 102–118.
CCDB · Cave1957 — Ornduff
CCDB · Cave1962 — Wiens & H. 1962
CCDB · DCDB-2016 — Ornduff, R. 1957. Documented chromosome numbers. Madroño 14: 111-112.
CCDB · DCDB-2016 — Warnock, M. J. 1995. Documented chromosome reports and supplementary information on previously reported chromosome counts of North American Delphinium. Phytologia 18(2): 102-118.
CCDB · DCDB-2016 — Sutherland, D. M. 1967. A taxonomic revision of the low larkspurs of the Pacific Northwest. Ph. D. disertation. University of Washington, Seatle, Whashintgon.
n 162×CCDB · book-ipcn73-74 · CCDB · DCDB-2016
CCDB · book-ipcn73-74 — POJAR, J. 1973. Levels of polyploidy in four vegetation types of southwestern British Columbia. Canad. J. Bot. 51: 621-628. I
CCDB · DCDB-2016 — Pojar, J. 1973. Levels of polyploidy in four vegetation types of southwestern British Columbia. Canad. J. Bot. 51: 621-628.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type9 659 records
Wild obs. + sensor5 728
Museum / vouchered3 931
Origin
Native12
Introduced3
Range
Area of Occupancy AOO20 316 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy92% within 1 km
≤100 m 3 496≤1 km 576≤10 km 226>10 km 135
4 433 georeferenced · 1 295 without coordinates
Open the mapobservation + sensor5 728
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy62% within 1 km
≤100 m 267≤1 km 998≤10 km 707>10 km 60
2 032 georeferenced · 1 899 without coordinates
Open the institutions mapphysical evidence3 931
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions70 of 106 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Pullman, US | 576 |
| Corvallis, US | 313 |
| WTUlocation not on record | 303 |
| Bronx, US | 300 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 159 |
| Moscow, US | 156 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 151 |
| Arcata, US | 139 |
| Boise, US | 119 |
| Denver, US | 87 |
| Provo, US | 80 |
| Pocatello, US | 79 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 71 |
| Flagstaff, US | 71 |
| Claremont, US | 67 |
| Wuzhou, CN | 60 |
| Logan, US | 60 |
| Ashland, US | 57 |
| Caldwell, US | 55 |
| Victoria, CA | 52 |
| Riverside, US | 52 |
| Davis, US | 47 |
| CASlocation not on record | 47 |
| Cheney, US | 36 |
| Bozeman, US | 36 |
| Pittsburg, US | 35 |
| Missoula, US | 35 |
| Durango, US | 34 |
| Orem, US | 33 |
| Chadron, US | 31 |
| ASUlocation not on record | 24 |
| Vancouver, CA | 24 |
| DOI/NPS, Greenbelt Parklocation not on record | 22 |
| Phoenix, US | 22 |
| Angwin, US | 21 |
| Santa Barbara, US | 21 |
| Canadian Department of Agriculturelocation not on record | 20 |
| Albuquerque, US | 20 |
| Chongqing Museumlocation not on record | 19 |
| Rocky Mountain Biological Laboratorylocation not on record | 17 |
| Bandelier National Monumentlocation not on record | 14 |
| Grand Junction, US | 13 |
| San Diego, US | 13 |
| University of Alberta Museumslocation not on record | 12 |
| San Jose, US | 11 |
| Henderson, US | 10 |
| Weber State Universitylocation not on record | 10 |
| Portland, US | 9 |
| Bend, US | 8 |
| Emporia, US | 8 |
| Walla Walla, US | 8 |
| Tacoma, US | 7 |
| Truckee, US | 7 |
| University of Stellenboschlocation not on record | 7 |
| US | 7 |
| Bloomington, US | 7 |
| San Francisco, US | 6 |
| Spearfish, US | 6 |
| San Luis Obispo, US | 6 |
| Tampa, US | 6 |
| Fredericton Stock Culture Collectionlocation not on record | 5 |
| US | 5 |
| Columbia, US | 4 |
| Whitehorse, CA | 4 |
| Los Angeles, US | 4 |
| Brookings, US | 4 |
| IDElocation not on record | 4 |
| KNFHClocation not on record | 3 |
| Mexico City, MX | 3 |
| Northridge, US | 3 |
| Dekalb, US | 3 |
| USFSlocation not on record | 3 |
| STNFlocation not on record | 3 |
| EL PASO, US | 3 |
| Madison, US | 2 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 2 |
| Fullerton, US | 2 |
| Lincoln, US | 2 |
| VALElocation not on record | 2 |
| Uniwersytet Jagiellońskilocation not on record | 2 |
| AUAlocation not on record | 2 |
| Saint Louis, US | 1 |
| Bureau of Land Managementlocation not on record | 1 |
| B.A. Bennett Herbariumlocation not on record | 1 |
| Irvine, US | 1 |
| Auckland, NZ | 1 |
| Bureau of Land Management, Medford District Officelocation not on record | 1 |
| Kew, GB | 1 |
| Bothell, US | 1 |
| Chapel Hill, US | 1 |
| Oskarshamn, SE | 1 |
| Long Beach, US | 1 |
| University of Tennessee at Chattanoogalocation not on record | 1 |
| Bourges, FR | 1 |
| BAYLUlocation not on record | 1 |
| Jurica-Suchy Nature Museumlocation not on record | 1 |
| Pacific Lutheran Universitylocation not on record | 1 |
| University of British Columbia, Herbariumlocation not on record | 1 |
| Research Collection of B. A. Bennettlocation not on record | 1 |
| Beijing, CN | 1 |
| Millersville, US | 1 |
| Meguro Parasitological Museumlocation not on record | 1 |
| Eastern Nevada Landscape Coalitionlocation not on record | 1 |
| Austin, US | 1 |
| University of Lethbridgelocation not on record | 1 |
| Yellowstone National Park Herbariumlocation not on record | 1 |
106 institutions · 3 816 of 3 931 vouchered records shown · 115 without an institution code
09Environmental DNA5 detections
Where the DNA of Delphinium nuttallianum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found5
Studies independent surveys1
Countries2
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 5 detections have coordinates
Open the map2 countries0
Open Pinus ponderosa / Festuca bunchgrass co…Granite rocks
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median13.0 °C 5.90–14.5
Seasonal swing summer↔winter22.6 °C
Max temp (day)18.4 °C 11.0–21.2
Min temp (night)7.40 °C 0.2–7.50
Precipitation69.0 mm/mo 51.4–99.4
Air humidity52.6 % 50.6–59.1
Moisture balance-36.1 mm/mo -74.2–-17.5
Vapour deficit643 Pa 424–814
Wind speed2.30 m/s 1.50–2.60
Cloud cover37.6 % 27.3–42.0
CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.