Delphinium grandiflorum
speciesAt a glance
Occurrence records2 371
Data sources11
Biological traits43
DNA specimens5
eDNA detections6
Sources11 archives
Databases and archives Delphinium grandiflorum's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility2 371 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics5 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements3 literature sources43 traits
Chemical compositionLOTUS19 compounds
Occurrence & distributionGBIF2 371 records
Environmental DNA1 datasets · 2 countries6 detections
DNA & barcodingBOLD · NCBI5 specimens
Genome at a glanceCCDB2n = 16
01Narrative
Жи́вокость крупноцветко́вая, или дельфи́ниум крупноцветковый, — вид травянистых растений, относящийся к роду Живокость семейства Лютиковые (Ranunculaceae). Популярное декоративное растение родом из Восточной Сибири и прилегающих регионов.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTTRY
Size & morphology16
Fruit length11.67 mm
Fruit length max19 mm
Fruit length min2 mm
Leaf length41 mm
Leaf length max60 mm
Leaf length min22 mm
Leaf size108 mm²
Leaf width62.5 mm
Leaf width max85 mm
Leaf width min40 mm
Plant height0.5 m
⚠ sources differ — GIFT: 0.5 m · TRY: 0.6 m
Plant height max0.65 m
Plant height min0.25 m
Seed mass1 mg
⚠ sources differ — TRY: 1 mg · GIFT: 1.21 mg
Seed mass max1.42 mg
Seed mass min1 mg
Life cycle & reproduction6
Flowering endAug
Flowering startJun
Life formperennial
Life spanperennial
Raunkiær life formtherophyte
Sex typehermaphrodite
Diet & foraging1
Parasiteindependent
Habitat & environment11
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max2 800 m
Elevation mean1 650 m
Elevation min500 m
Epiphyteterrestrial
Growth formherb
Habitat GIFTmeadows: dry, mountains, rivers, stony places
Leaf formlinear
Woodinessnon-woody
Physiology & chemistry6
Leaf c417 mg/g
Leaf dry-matter content (LDMC)327 mg/g
Leaf n21.65 mg/g
Leaf p2.03 mg/g
Photosynthetic pathwayC3
Specific leaf area (SLA)16.22 mm²/mg
Other traits3
Leaf margindissected
Leaf spinesno
Leaf thornsno
03Chemical composition19 compounds
Compounds documented for Delphinium grandiflorum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile3 classes
Terpenoid alkaloids16
Hasubanan alkaloids $ Terpenoid alkaloids2
Isoquinoline alkaloids1
Documented compounds19 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (1S,2R,3R,4S,5R,6S,8R,9S,10S,13S,16S,17R,18S)-11-ethyl-4,6,16,18-tetramethoxy-13-(methoxymethyl)-11-azahexacyclo[7.7.2.12,5.01,10.03,8.013,17]nonadecane-8,9-diol | present | LOTUS | |
| (1S,2R,3R,4S,5S,6S,8R,9R,10R,13R,16S,17R,18R)-11-ethyl-6,8,16-trimethoxy-13-methyl-11-azahexacyclo[7.7.2.12,5.01,10.03,8.013,17]nonadecane-4,18-diol | present | LOTUS | |
| (1S,2R,3R,4S,5S,6S,8R,9S,10S,13S,16S,17R,18S)-11-ethyl-6,18-dimethoxy-13-(methoxymethyl)-11-azahexacyclo[7.7.2.12,5.01,10.03,8.013,17]nonadecane-4,8,9,16-tetrol | present | LOTUS | |
| (1S,2S,3S,4S,5R,6R,8S,9S,10S,13S,16S,17R,18R)-11-ethyl-6,8,18-trimethoxy-13-(methoxymethyl)-11-azahexacyclo[7.7.2.12,5.01,10.03,8.013,17]nonadecane-4,9,16-triol | present | LOTUS | |
| (1S,3S,5S,8R,9S,11R,14R,16S,17R,18R,19S)-5-methyl-12-methylidene-7-azaheptacyclo[9.6.2.01,8.05,17.07,16.09,14.014,18]nonadecane-3,10,19-triol | present | LOTUS | |
| (1S,5S,8R,9S,11R,14R,16S,17R,18R,19S)-10,19-dihydroxy-5-methyl-12-methylidene-7-azaheptacyclo[9.6.2.01,8.05,17.07,16.09,14.014,18]nonadecan-3-one | present | LOTUS | |
| (2,6,10,19-Tetrahydroxy-5-methyl-12-methylidene-7-azaheptacyclo[9.6.2.01,8.05,17.07,16.09,14.014,18]nonadecan-3-yl) benzoate | present | LOTUS | |
| 13-Methyl-12,12a,13,14-tetrahydro-2H,6H,9H-6a,14-epoxy(1,3)dioxolo(4,5-i)(1,3)dioxolo(5,6)indeno(2,1-c)(2)benzazepine | present | LOTUS | |
| [(1S,2R,3R,4S,5R,6S,8R,9R,10S,13S,16S,17R,18S)-11-ethyl-8,9,16-trihydroxy-4,6,18-trimethoxy-11-azahexacyclo[7.7.2.12,5.01,10.03,8.013,17]nonadecan-13-yl]methyl 2-[(3S)-3-methyl-2,5-dioxopyrrolidin-1-yl]benzoate | present | LOTUS | |
| [(1S,2R,3R,4S,5R,6S,8R,9S,10S,13S,16S,17R,18S)-11-ethyl-8,9,16-trihydroxy-4,6,18-trimethoxy-11-azahexacyclo[7.7.2.12,5.01,10.03,8.013,17]nonadecan-13-yl]methyl 2-[(3S)-3-methyl-2,5-dioxopyrrolidin-1-yl]benzoate | present | LOTUS |
05DNA & barcoding5 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Delphinium grandiflorum has left across the world's sequence archives.
At a glance
DNA specimens5
Marker genes4
GenBank sequences10
eDNA detections6
Countries2
The DNA barcodea real sequence read deposited for this species
CACACAGCGTCGCACCCCGCCAACCAGGTTGACGGGGAGCGGAGACTGGCCCCCCGTGCCCGCACGGGCACGGTCGGCACAAATTTTGGT …
Delphinium grandiflorum voucher ZX-8701 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL5★ITS3★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Delphinium grandiflorum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 16 n = 8
Ploidydiploid inferred
Chromosome records16–322n range16median16mode29records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1626×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-ipcn75-78 +2
CCDB · ipcn-api-dl — Rostovtseva, T. S. 1984. Khrom. Chisla Tsvet. Nauka, Novosibirsk.
CCDB · ipcn-api-dl — Krogulevich, R. E. 1978. Kariologicheskij analiz vidov flory Vostochnogo Sajana. V Flora Pribajkal'ja. 19–48. Nauka, Novosibirsk.
CCDB · ipcn-api-dl — Murin, A., I. Haberova & C. Zamsran. 1984. Further karyological studies of the Mongolian flora. Folia Geobot. Phytotax. 19: 28–39.
CCDB · ipcn-api-dl — Friesen, N. V. 1991. Chromosome numbers in members of the Ranunculaceae family from Siberia. Bot. Žhurn. (Moscow & Leningrad) 76: 905–907.
CCDB · ipcn-api-dl — Al-kelidar, R. K. & A. J. Richards. 1981. Chromosomal indications of evolutionary trends in the genus Delphinium L. Cytologia 46: 623–633.
CCDB · ipcn-api-dl — Yang, Q. e. 2001. Cytology of 12 species in Aconitum L. and of 18 species in Delphinium L. of the tribe Delphineae (Ranunculaceae) from China. Acta Phytotax. Sin. 39(6): 502–514.
CCDB · ipcn-api-dl — Probatova. 2006. Chromosome numbers of some plant species of the Primkorsky Territory and the Amur River basin. Bot. Žhurn. (Moscow & Leningrad) 91(5): 785–804.
CCDB · book-ipcn67-71 — JANKUN, A. 1968. Studies in Delphinium grandiflorum L. Acta Biol. Cracov. Ser. Bot. 11: 71-77.
CCDB · book-ipcn75-78 — Krogulevich 1978
CCDB · DCDB-2016 — Langlet, O. F. 1927. Beirträge zur Zytologie der Ranunculazeen. Svensk Bot. Tidskr. 21(1): 1-17.
CCDB · DCDB-2016 — Al-Kelidar, R. K. & A. J. Richards. 1981. Chromosomal indications of evolutionary trends in the genus Delphinium L. Cytologia 46: 623-633.
CCDB · DCDB-2016 — Friesen, N. V. 1991. Chromosome numbers in members of the Ranunculaceae family from Siberia. Bot. Zhurn. (Moscow & Leningrad) 76(6): 905-906.
CCDB · DCDB-2016 — Jankun, A. 1968. Studies in Delphinium grandiflorum L. Acta Biol. Cracov., Sér. Bot. 11: 71-75.
CCDB · DCDB-2016 — Krasnikov, A. A. & D. N. Schaulo. 2004. Karyological study of the Tuva republic flora: summary. Turczaninowia 7(2): 82–95.
CCDB · DCDB-2016 — Krogulevich, R. E. & T. C. Rostovtseva. 1984. Aconitum, Chromosome number of flowering plants of Siberia and the Soviet Far East. Nauka. Novosibirsk.: 93-98.
CCDB · DCDB-2016 — Krogulevich, R. E. 1978. Karyological analysis of the species of the flora of eastern Sayana. In L.I. Malyshev & G.A. Peshlcova (eds.). Flora of the Prebaikal: 19-48. Novosibirsk.
CCDB · DCDB-2016 — Murín, A., I. Haberova & C. Zamsran. 1984. Further karyological studies of the Mongolian flora. Folia Geobot. Phytotax. Bohem. 19: 28-39.
CCDB · DCDB-2016 — Probatova, N. S. 2006. Chromosome numbers of some plant species of the Primkorsky Territory and the Amur River basin. Bot. Žhurn. (Moscow & Leningrad) 91(5): 785–804.
CCDB · DCDB-2016 — Propach, H. 1940. Einige chromosomenzahle von Delphinien. Gartenbauwissenschaft 14: 642-650.
CCDB · DCDB-2016 — Yang, Q. E. 2001. Citology of 12 species in Aconitum and 18 species in Delphinium L. in the tribe Delphineae (Ranunculaceae) from China. Acta Phytotax. Sin. 39(1): 502-514.
CCDB · DCDB-2016 — Yuan, Q. & Q. E. Yang. 2008. Low incidence of polyploids and high uniformity of karyotypes displayed by Delphinium (Ranunculaceae) in south-west China’s Hengduan Mountains region. Bot. J. Linn. Soc. 158(1): 172-188.
CCDB · DCDB-2016 — Gage, M. A. 1953. The citology, morphology, and systematic relationships of Delphinium x Belladonna Hort. ex. Bergm. Ann. Missouri Bot. Gard. 40: 113-183.
CCDB · DCDB-2016 — Giménez, M. 1995. Estudios citogenéticos en especies anuales de la tribu Delphineae en Turquía. Master Thesis. Facultat de Farmàcia. Universitat de Barcelona. Barcelona.
CCDB · iapt — IAPT/IOPB Chromosome Data 35
2n 202×CCDB · iapt · CCDB · DCDB-2016
CCDB · iapt — IAPT/IOPB Chromosome Data 11
CCDB · DCDB-2016 — Krivenko, D. A., V. V. Kotseruba, S. G. Kazanovsky, A. V. Verkhozina & А. V. Stepanov. 2011. In K. Marhold & I. Breitwieser (eds.) IAPT/IOPB chromosome number reports 11. Taxon 60(4):1220-1223.
2n 321×CCDB · DCDB-2016
CCDB · DCDB-2016 — Gregory, W. C. 1941. Phylogenetic and cytological studies in the Ranunculaceae. Trans. Amer. Phil. New Ser. 31: 443-520.
n 83×CCDB · ipcn-api-dl · CCDB · DCDB-2016
CCDB · ipcn-api-dl — Al-kelidar, R. K. & A. J. Richards. 1981. Chromosomal indications of evolutionary trends in the genus Delphinium L. Cytologia 46: 623–633.
CCDB · DCDB-2016 — Gregory, W. C. 1941. Phylogenetic and cytological studies in the Ranunculaceae. Trans. Amer. Phil. New Ser. 31: 443-520.
CCDB · DCDB-2016 — Rostovtseva, T. S. 1981. Chromosome numbers of some species of the family Ranunculaceae, II. Bot. Zhurn. (Moscow & Leningrad) 66(12): 1751-1755.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type2 371 records
Wild obs. + sensor1 289
Museum / vouchered1 077
Cultivated / captive1
Other4
Range
Area of Occupancy AOO5 424 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy61% within 1 km
≤100 m 462≤1 km 111≤10 km 90>10 km 284
947 georeferenced · 342 without coordinates
Open the mapobservation + sensor1 289
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy11% within 1 km
≤100 m 4≤1 km 27≤10 km 225>10 km 18
274 georeferenced · 803 without coordinates
Open the institutions mapphysical evidence1 077
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 1 records without
Open the mapnot free-living1
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions38 of 82 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Beijing, CN | 252 |
| Moscow State Universitylocation not on record | 145 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 62 |
| Northeastern Forestry Universitylocation not on record | 50 |
| Beijing Normal Universitylocation not on record | 37 |
| Yangling, CN | 36 |
| Xining, CN | 22 |
| NSMKlocation not on record | 20 |
| Kunming, CN | 20 |
| Inner Mongolia Universitylocation not on record | 19 |
| ENTClocation not on record | 17 |
| Jiangxi College of Educationlocation not on record | 16 |
| SXTCMlocation not on record | 15 |
| Shanxi Institute of Biologylocation not on record | 12 |
| Nanjing, CN | 11 |
| Tianjin Natural History Museumlocation not on record | 7 |
| “Manash Kozybayev North Kazakhstan University" NPLClocation not on record | 7 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 6 |
| IWEP FEB RASlocation not on record | 6 |
| Xinxiang, CN | 6 |
| South Kensington, GB | 5 |
| Capital Normal Universitylocation not on record | 5 |
| Bern, CH | 5 |
| BRNUlocation not on record | 5 |
| CASlocation not on record | 5 |
| Northeast Institute of Geography and Agroecology, Chinese Academy of Scienceslocation not on record | 5 |
| Mlocation not on record | 4 |
| Guangzhou, CN | 4 |
| Denver, US | 4 |
| Helsinki, FI | 3 |
| Tampa, US | 3 |
| Lanzhou, CN | 3 |
| Bando, JP | 3 |
| Port Elizabeth Museum (Bayworld)location not on record | 3 |
| Peking Universitylocation not on record | 3 |
| Bronx, US | 3 |
| Tartu, EE | 3 |
| Hebei Normal Universitylocation not on record | 3 |
| Beijing Natural History Museumlocation not on record | 3 |
| Tampere, FI | 3 |
| Cambridge, US | 3 |
| sxphclocation not on record | 3 |
| Durham, US | 3 |
| Saint Louis, US | 3 |
| Forest Survey and Design Institute, Forestry Administrative Bureau of Daxinganlinglocation not on record | 2 |
| Chongqing Natural History Museumlocation not on record | 2 |
| TUR-Alocation not on record | 2 |
| Servico de Microbiologia e Imunologialocation not on record | 2 |
| Chengdu, CN | 2 |
| Zhengzhou, CN | 2 |
| Karlsruhe, DE | 2 |
| Wuhan, CN | 2 |
| Awka, NG | 2 |
| SLU Artdatabankenlocation not on record | 2 |
| Beijing, CN | 2 |
| Guilin, CN | 2 |
| Shanxi Universitylocation not on record | 2 |
| IMMUlocation not on record | 2 |
| Santa Barbara, US | 2 |
| nlocation not on record | 2 |
| Philadelphia, US | 1 |
| Natural History Museum, Tribhuvan Universitylocation not on record | 1 |
| University of Alberta Museumslocation not on record | 1 |
| Taipei, TW | 1 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 1 |
| Chiba, JP | 1 |
| Zhejiang Universitylocation not on record | 1 |
| Northern Arizona University, School of Forestrylocation not on record | 1 |
| WNNUlocation not on record | 1 |
| XAJDlocation not on record | 1 |
| Barcelona, ES | 1 |
| BClocation not on record | 1 |
| Montréal, CA | 1 |
| Shanghai, CN | 1 |
| Edinburgh, GB | 1 |
| Chengdu, CN | 1 |
| Québec, CA | 1 |
| Uniwersytet Śląski w Katowicachlocation not on record | 1 |
| Lanzhou Institute of Desert Research, Academia Sinicalocation not on record | 1 |
| Chinese Academy of Forestrylocation not on record | 1 |
| Hangzhou, CN | 1 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 1 |
82 institutions · 907 of 1 077 vouchered records shown · 170 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA6 detections
Where the DNA of Delphinium grandiflorum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found6
Studies independent surveys1
Countries2
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 6 detections have coordinates
Open the map2 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.3 °C 13.1–17.4
Seasonal swing summer↔winter25.1 °C
Max temp (day)20.5 °C 17.2–23.7
Min temp (night)9.40 °C 7.80–11.0
Precipitation92.4 mm/mo 76.4–108
Air humidity54.4 % 51.4–57.3
Moisture balance-32.6 mm/mo -76.0–10.8
Vapour deficit855 Pa 723–988
Wind speed2.30 m/s 1.80–2.80
Cloud cover29.5 % 20.2–38.8
CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.