Delphinium geyeri

Greene · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ranunculales/Ranunculaceae/Delphinium

At a glance

Occurrence records560

Data sources11

Biological traits12

DNA specimens1

eDNA detections1

Sources11 archives

Databases and archives Delphinium geyeri's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility560 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Chemical compositionLOTUS · NPASS54 compounds

Occurrence & distributionGBIF560 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 16

01Narrative

Delphinium geyeri là một loài thực vật có hoa trong họ Mao lương. Loài này được Greene mô tả khoa học đầu tiên năm 1894.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass2.07 mg

Seed mass max2.07 mg

Seed mass min2.07 mg

Life cycle & reproduction2

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

03Chemical composition54 compounds

Compounds documented for Delphinium geyeri across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Quinolizidine alkaloids13

Onocerane triterpenoids4

Terpenoid alkaloids3

Disaccharides1

Pyridine alkaloids1

Documented compounds54 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Onocerin	present	NPASS
(-)-Lycopodine	present	NPASS
(1R,2R,10S,11R,13S,14R,15S)-15-methyl-6-azatetracyclo[8.6.0.01,6.02,13]hexadecane-11,14-diol	present	NPASS
(1R,2R,10S,13R,14S,15R)-15-methyl-6-azatetracyclo[8.6.0.01,6.02,13]hexadecan-14-ol	present	NPASS
(1R,2R,10S,13S,15S)-15-methyl-6-azatetracyclo[8.6.0.01,6.02,13]hexadecan-11-one	present	NPASS
(1R,2S,10R,11S,13S,15S)-11-hydroxy-15-methyl-6-azatetracyclo[8.6.0.01,6.02,13]hexadecan-14-one	present	NPASS
(1R,2S,4aR,6S,8aS)-1-[2-[(1S,4aR,6S,8aR)-6-hydroxy-5,5,8a-trimethyl-2-methylidene-3,4,4a,6,7,8-hexahydro-1H-naphthalen-1-yl]ethyl]-5,5,8a-trimethyl-1,2,3,4,4a,6,7,8-octahydronaphthalene-2,6-diol	present	NPASS
(1R,9S,10R,16R)-16-methyl-6,14-diazatetracyclo[7.5.3.01,10.02,7]heptadeca-2(7),3-dien-5-one	present	NPASS
(1R,9S,10R,16S)-16-methyl-6,14-diazatetracyclo[7.5.3.01,10.02,7]heptadec-2(7)-en-5-one	present	NPASS
(1R,9S,10R,16S)-16-methyl-6,14-diazatetracyclo[7.5.3.01,10.02,7]heptadeca-2(7),3-dien-5-one	present	NPASS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Delphinium geyeri has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSAF258762.1 ↗614 bp

ACGT

GTCGAAACCTGCCCAGCAGAGCGACCCGCGAACGAGTGAAAACAAACCGGGACGGAACGGTTGGGGGCGTNCGCCCCCGATCGGCCGTCG …

Delphinium geyeri 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete sequence; 5.8S ribosomal RNA gene, complete sequence; internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Delphinium geyeri carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records16–322n range16median16mode7records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 165×CCDB · book-ipcn67-71 · CCDB · book-ipcn73-74 · CCDB · eflora +1

CCDB · book-ipcn67-71 — LOEVE, A, D. LOEVE, & B.M. KAPOOR. 1971. Cytotaxonomy of a century of Rocky Mountain orophytes. Arctic & Alpine Res. 3: 139-165.

CCDB · book-ipcn73-74 — CRAWFORD, D.J. & R.C. GARDNER. 1974. Documented plant chromosome numbers 1974: 2. Sida 5: 292-294.

CCDB · eflora

CCDB · DCDB-2016 — Crawford, D. J. & R. C. Gardner. 1974. Documented plant chromosome numbers 1974. II. Sida 5(4): 292-294.

CCDB · DCDB-2016 — Loeve, A., D. Loeve & B. M. Kapoor. 1971. Cytotaxonomy of a century of Rocky Mountain orophhytes. Arctic & Alpine Res. 3: 139-165.

2n 322×CCDB · ipcn-api-dl · CCDB · DCDB-2016

CCDB · ipcn-api-dl — Al-kelidar, R. K. & A. J. Richards. 1981. Chromosomal indications of evolutionary trends in the genus Delphinium L. Cytologia 46: 623–633.

CCDB · DCDB-2016 — Al-Kelidar, R. K. & A. J. Richards. 1981. Chromosomal indications of evolutionary trends in the genus Delphinium L. Cytologia 46: 623-633.

n 82×CCDB · ipcn-api-dl · CCDB · DCDB-2016

CCDB · ipcn-api-dl — Warnock, M. J. 1995. Documented chromosome reports and supplementary information on previously reported chromosome counts of North American Delphinium. Phytologia 78(2): 102–118.

CCDB · DCDB-2016 — Warnock, M. J. 1995. Documented chromosome reports and supplementary information on previously reported chromosome counts of North American Delphinium. Phytologia 18(2): 102-118.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type560 records

Wild obs. + sensor285

Museum / vouchered273

Cultivated / captive2

Range

Area of Occupancy AOO1 444 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 160≤1 km 34≤10 km 17>10 km 20

231 georeferenced · 54 without coordinates

Open the mapobservation + sensor285

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 9≤1 km 61≤10 km 65>10 km 6

141 georeferenced · 132 without coordinates

Open the institutions mapphysical evidence273

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions25 of 34 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	68
Musee des Dinosaures d'Esperaza (Aude)location not on record	50
DOI/NPS, Colonial National Historical Parklocation not on record	26
Denver, US	23
DOI/NPS, Greenbelt Parklocation not on record	21
Moscow, US	21
Chadron, US	11
Logan, US	5
Pullman, US	4
Chongqing Museumlocation not on record	4
Bozeman, US	3
Eastern Nevada Landscape Coalitionlocation not on record	3
Provo, US	3
Wuzhou, CN	3
Flagstaff, US	3
Claremont, US	2
Northridge, US	2
Lincoln, US	2
Fullerton, US	2
San Luis Obispo, US	2
Tempe, US	2
Columbia, US	1
Spearfish, US	1
Pocatello, US	1
Rocky Mountain Biological Laboratorylocation not on record	1
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	1
Albuquerque, US	1
Pittsburg, US	1
Boise, US	1
AUAlocation not on record	1
Durango, US	1
Grand Junction, US	1
ASUlocation not on record	1
Riverside, US	1

34 institutions · 273 of 273 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Delphinium geyeri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)