Delphinium elatum
speciesAt a glance
Occurrence records7 136
Data sources12
Biological traits30
DNA specimens15
eDNA detections10
Sources12 archives
Databases and archives Delphinium elatum's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility7 136 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics15 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources30 traits
Chemical compositionLOTUS · NPASS72 compounds
Occurrence & distributionGBIF7 136 records
Environmental DNA1 datasets · 3 countries10 detections
DNA & barcodingBOLD · NCBI15 specimens
Genome at a glanceCCDB2n = 32
01Narrative
Delphinium elatum, la dauphinelle élevée, est une espèce de plantes vivaces de la famille des Renonculacées, originaire d'Europe et d'Asie occidentale. Autre nom vernaculaire : pied-d'alouette élevé. Le terme de pied-d'alouette désigne aussi bien les espèces du genre Delphinium que du genre Consolida. Les horticulteurs ont produit de nombreux hybrides cultivés dont Delphinium ×elatum. Le croisement de D. elatum et D. grandiflorum a donné l'hybride Delphinium ×belladonna avec de nombreuses variétés de bleus vifs. D'autres hybrides de D. elatum, très communs dans les jardins, sont constitués par la série des Giant Pacific.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology8
Plant height1.25 m
⚠ sources differ — GIFT: 1.25 m · LEDA: 1.25 m · TRY: 1.62 m
Plant height generative1.03 m
Plant height max1.6 m
Plant height min0.6 m
Seed length2.49 mm
Seed mass2.25 mg
⚠ sources differ — TRY: 2.25 mg · LEDA: 1.86 mg · GIFT: 2.34 mg
Seed mass max2.83 mg
Seed mass min2.83 mg
Life cycle & reproduction7
Dispersal typeself
Flowering endAug
Flowering startAug
Life formperennial
Life spanpoly-annuals 5-50 years (medium-lived perennials)
⚠ sources differ — TRY: poly-annuals 5-50 years (medium-lived perennials) · LEDA: poly-annuals 5-50 years (medium-lived perennials) · GIFT: perennial
Raunkiær life formhemicryptophyte
Sex typehermaphrodite
Diet & foraging1
Parasiteindependent
Habitat & environment11
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max2 100 m
Elevation mean2 298 m
Elevation min1 890 m
Epiphyteterrestrial
Growth formherb
Habitat GIFTcut-over forest, forest, forest edges, meadows, rivers, shrubberies
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry2
Leaf dry-matter content (LDMC)195 mg/g
Photosynthetic pathwayC3
Other traits1
Diaspore typeseed
03Chemical composition72 compounds
Compounds documented for Delphinium elatum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile2 classes
Terpenoid alkaloids61
Simple phenolic acids2
Documented compounds72 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (11-Ethyl-4,8,9-trihydroxy-6,16,18-trimethoxy-11-azahexacyclo[7.7.2.12,5.01,10.03,8.013,17]nonadecan-13-yl)methyl 2-(3-methyl-2,5-dioxopyrrolidin-1-yl)benzoate | present | LOTUS | |
| (13R,21xi)-Hetisan-2alpha,11alpha,13-triol | present | LOTUS | |
| (1R,2R,3R,4R,5S,6S,8R,12R,13R,16S,19S,20S,21S)-14-ethyl-6-methoxy-16-methyl-9,11-dioxa-14-azaheptacyclo[10.7.2.12,5.01,13.03,8.08,12.016,20]docosane-4,19,21-triol | present | LOTUS | |
| (1R,2R,3R,4R,5S,6S,8R,9R,10R,13R,16R,17S,18S)-11-ethyl-13-(hydroxymethyl)-6,16,18-trimethoxy-11-azahexacyclo[7.7.2.12,5.01,10.03,8.013,17]nonadecane-4,8,9-triol | present | LOTUS | |
| (1R,2S,3S,4R,5S,6S,8S,12R,13R,16S,19R,20S,21S)-14-ethyl-4,6,19-trimethoxy-16-methyl-9,11-dioxa-14-azaheptacyclo[10.7.2.12,5.01,13.03,8.08,12.016,20]docosan-21-ol | present | LOTUS | |
| (1R,2S,3S,4S,5R,6R,8S,12R,13R,16S,19R,20S,21S)-14-ethyl-6,19-dimethoxy-16-methyl-9,11-dioxa-14-azaheptacyclo[10.7.2.12,5.01,13.03,8.08,12.016,20]docosane-4,21-diol | present | LOTUS | |
| (1R,2S,3S,4S,5R,6S,8R,12S,13S,16R,19S,20R,21S)-14-ethyl-4,6,19-trimethoxy-16-methyl-9,11-dioxa-14-azaheptacyclo[10.7.2.12,5.01,13.03,8.08,12.016,20]docosane-2,21-diol | present | LOTUS | |
| (1R,2S,3S,4S,5R,6S,8R,9S,10S,13S,16S,17R,18S)-11-ethyl-13-(hydroxymethyl)-4,6,16,18-tetramethoxy-11-azahexacyclo[7.7.2.12,5.01,10.03,8.013,17]nonadecane-2,8,9-triol | present | LOTUS | |
| (1R,2S,3S,4S,5R,6S,8S,9S,10R,13S,16S,17S)-11-ethyl-6,8-dimethoxy-13-methyl-11-azahexacyclo[7.7.2.12,5.01,10.03,8.013,17]nonadecane-4,9,16-triol | present | LOTUS | |
| (1S,2R,3R,4S,5R,6S,8R,12S,13S,16R,19S,20R,21S)-14-ethyl-4,6,19-trimethoxy-16-methyl-9,11-dioxa-14-azaheptacyclo[10.7.2.12,5.01,13.03,8.08,12.016,20]docosan-21-ol | present | LOTUS |
05DNA & barcoding15 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Delphinium elatum has left across the world's sequence archives.
At a glance
DNA specimens15
Marker genes6
GenBank sequences10
eDNA detections10
Countries3
The DNA barcodea real sequence read deposited for this species
ACGTAGTGAAAACAAACCGGGACGGAACGGTCGGGGGCGTCCGCCCCCGATCGGCCGTTCGTCGGGCCCGGGTAGCCGCCTCGGAAGGGG …
Delphinium elatum voucher ALT23-180 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL4★rbcLa★ITS4★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Delphinium elatum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 32 n = 16
Ploidypolyploid inferred
Chromosome records16–482n range32median32mode104records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 3292×CCDB · slov-fl · CCDB · iapt · CCDB · fl-europaea +12
CCDB · slov-fl — Májovský J. et al., 1974a: Index of chromosome numbers of Slovakian flora (Part 3). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 22: 1-20.
CCDB · slov-fl — Gajewski W., 1963: Cytogenetic relationships between Delphinium oxysepalum Borb. et Pax and D. elatum L. from Tatra Mountains. - Acta Soc. Bot. Poloniae 32/2: 281-293.
CCDB · iapt — IAPT/IOPB Chromosome Data 14
CCDB · fl-europaea — Sokolovskaya &
CCDB · poland — Jankun A. 1973. Further studies in the development of hybrid endosperm in representatives of the genus Delphinium L. Acta Biol. Cracov. Ser. Bot. 16, 215-225.
CCDB · poland — Gajewski W. 1963. Cytogenetic relationship between Delphinium oxysepalum Borb. et Pax and D. elalum L. from Tatra Mountains. Acta Soc. Bot. Pol. 32, 281-294.
CCDB · ipcn-api-dl — Lavrenko, A. N. & N. P. Serditov. 1985. Karyosystematic study of Ranunculaceae and Paeoniaceae in the north-east of the European part of the USSR. Bot. Zhurn. SSSR 70(10): 1346–1354.
CCDB · ipcn-api-dl — Rostovtseva, T. S. 1984. Khrom. Chisla Tsvet. Nauka, Novosibirsk.
CCDB · ipcn-api-dl — Rubtsova, V. V. & T. S. Rostovtseva. 1975. Biologicheskie osobennosti i chislo khromosom nekotorykh vidov jakutskoj flory v uslovijakh Novosibirska. Bot. Issledovanija v Jakutii. 122–128. Jakutsk.
CCDB · ipcn-api-dl — Krogulevich, R. E. 1978. Kariologicheskij analiz vidov flory Vostochnogo Sajana. V Flora Pribajkal'ja. 19–48. Nauka, Novosibirsk.
CCDB · ipcn-api-dl — Krogulevich, R. E. 1976. Rol poliploidii v genesise flory Putorana. In: L. I. Malyshev, ed. 1976 Flora Putorana: Materali k Poznaniiu Osobennostei Sostava i Genezisia Gornykh Subarkticheskikh Flor Sibir. Novosibirsk. Nauka, Novosibirsk
CCDB · ipcn-api-dl — Kartashova, N. N., L. A. MALAKHOVA, Koslova & N. A. Dubrova. 1974. Chisla chromosom u rjada polesnykh rastenij is prirodnykh populjacij flory Priob'ja. Biol. Biofis. Tomsk. 47–53.
CCDB · ipcn-api-dl — Friesen, N. V. 1991. Chromosome numbers in members of the Ranunculaceae family from Siberia. Bot. Žhurn. (Moscow & Leningrad) 76: 905–907.
CCDB · ipcn-api-dl — Dobea, C., B. Hahn & W. Morawetz. 1997. Chromosomenzahlen zur Gefässpflanzen-Flora Österreichs. Linzer Biol. Beitr. 29(1): 5–43.
CCDB · ipcn-api-dl — Kirschner, J. & J. `tĕpánek. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · ipcn-api-dl — Rostovtseva, T. S. 1981. Chromosome numbers of some species of the family Ranunculaceae II. Bot. Zhurn. 66 (12): 1751–1755.
CCDB · ipcn-api-dl — Al-kelidar, R. K. & A. J. Richards. 1981. Chromosomal indications of evolutionary trends in the genus Delphinium L. Cytologia 46: 623–633.
CCDB · ipcn-api-dl — Malakhova, L. A., O. L. Voronova & A. A. KOZLOVA. 1979. Chromosome numbers of some species of the flora of Sibirian lime-forests. Chernevaja Tajga i Problema Reliktov. Tomsk. 47–51.
CCDB · ipcn-api-dl — Ishbirdina, L. M. & N. I. Fedotov. 2003. Karyologic analysis of Delphinium (Ranunculaceae) species in the southern Urals. Bot. Žhurn. (Moscow & Leningrad) 88(8): 8–19.
CCDB · ipcn-api-dl — Starmühler, U. 2000. In C. Dobea & E. Vitek, Documented Chromosome Number Checklist of Austrian Vascular Plants. Verlag des Naturhistorischen Museums Wien, Vienna.
CCDB · book-ipcn67-71 — ZHUKOVA, P. G. 1967. Karyology of some plants, cultivated in the Arctic-Alpine Botanical Garden. (In Russian). In N. A. Avrorin (ed.): Plantarum in Zonam Polarem Transportatio. II. Leningrad 1967, pp. 139-149.
CCDB · book-ipcn75-78 — Belaeva & Siplivinsky 1975
CCDB · book-ipcn75-78 — Krogulevich 1976
CCDB · book-ipcn75-78 — Kartashova et al. 1974
CCDB · book-ipcn75-78 — Rostovtseva 1976a
CCDB · book-ipcn73-74 — MAJOVSKY, J., ET AL. 1974. Index of chromosome numbers of Slovakian flora. (Part 3). Acta Fac. Rerum Nat. Univ. Comenianae Bot. 22: 1-20.
CCDB · book-indian_vol1 — Lewitsky, G.A. (Fedorov) ; Propach, H. 1940 ; Gregory, W.C. 1941 ; Delay. C. 1947; Satczek (Skalinska, M. et al. 1959) ; Skalinska, M. ei a/. 1959 ; Zhukova, P.G. (Fedorov), 1967b ; Gajewski, W. 1963
CCDB · book-fedorov — Kyxosa 1961
CCDB · book-fedorov — CoKOHOBCKaH 19626
CCDB · book-fedorov — JleBIITCKHH 1931B
CCDB · book-fedorov — Propach 1940a
CCDB · book-fedorov — Gregory W. C. 1941
CCDB · book-fedorov — Delay 1947
CCDB · book-fedorov — Satczek (Skalinska et al. 1959)
CCDB · book-fedorov — XyKOBa 1961
CCDB · book-fedorov — Gajewski 1963
CCDB · Cave1958 — Sokolovskaya 1958
CCDB · Cave1959 — Skalinska et al. 1959
CCDB · Cave1963 — Sokol. & Strel. 1962; Sokolovskaya 1962
CCDB · CromoCat 2015 — Al-Kelidar, R. K. & Richards,A. J. (1981). Chromosomal indications of evolutionary trends in genus Delphinium L. Cytologia 46: 623-633.
+48 more references
2n 486×CCDB · book-atlas-flowering-plants · CCDB · DCDB-2016
CCDB · book-atlas-flowering-plants — Langlet 1927a
CCDB · DCDB-2016 — Gage, M. A. 1953. The citology, morphology, and systematic relationships of Delphinium x Belladonna Hort. ex. Bergm. Ann. Missouri Bot. Gard. 40: 113-183.
CCDB · DCDB-2016 — Langlet, O. F. 1927. Beirträge zur Zytologie der Ranunculazeen. Svensk Bot. Tidskr. 21(1): 1-17.
CCDB · DCDB-2016 — Lawrence, W. J. C. 1936. On the origin of new forms in Delphinium. Genetica 18: 109-115.
CCDB · DCDB-2016 — Propach, H. 1939. Was ist eigenlich unsere Rittersporne? Garteschönh 20: 283-284.
CCDB · DCDB-2016 — Propach, H. 1940. Einige chromosomenzahle von Delphinien. Gartenbauwissenschaft 14: 642-650.
2n 244×CCDB · CromoCat 2015 · CCDB · DCDB-2016
CCDB · CromoCat 2015 — Krasnikov, A. A. & Schaulo, D. N. (1986). Chromosome numbers of some representatives of the families Apiaceae and Ranunculaceae from the South of Siberia. Bot. Žurn. 71: 116-117.
CCDB · DCDB-2016 — Subramanian, D. 1985. Cytotaxonomical studies in south Indian Ranunculaceae. Cytologia 50: 759-768.
CCDB · DCDB-2016 — Krasnikov, A. A. & D. N. Schaulo. 1986. Chromosome numbers of some representatives of the families Apiaceae and Ranunculaceae from the south of Siberia. Bot. Zhurn. (Moscow & Leningrad) 71(1): 116-117.
CCDB · DCDB-2016 — Krasnikov, A. A. & D. N. Schaulo. 2004. Karyological study of the Tuva republic flora: summary. Turczaninowia 7(2): 82–95.
2n 162×CCDB · iapt
CCDB · iapt — IAPT/IOPB Chromosome Data 27
CCDB · iapt — IAPT/IOPB Chromosome Data 35
n 164×CCDB · ipcn-api-dl · CCDB · Cave1963 · CCDB · CromoCat 2015 +1
CCDB · ipcn-api-dl — Al-kelidar, R. K. & A. J. Richards. 1981. Chromosomal indications of evolutionary trends in the genus Delphinium L. Cytologia 46: 623–633.
CCDB · Cave1963 — Gajewski 1963
CCDB · CromoCat 2015 — Al-Kelidar, R. K. & Richards,A. J. (1981). Chromosomal indications of evolutionary trends in genus Delphinium L. Cytologia 46: 623-633.
CCDB · DCDB-2016 — Rostovtseva, T. S. 1981. Chromosome numbers of some species of the family Ranunculaceae, II. Bot. Zhurn. (Moscow & Leningrad) 66(12): 1751-1755.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type7 136 records
Wild obs. + sensor5 817
Museum / vouchered1 102
Cultivated / captive2
Other215
Origin
Native3
Introduced2
Range
Area of Occupancy AOO17 832 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy61% within 1 km
≤100 m 2 448≤1 km 485≤10 km 1 275>10 km 574
4 782 georeferenced · 1 035 without coordinates
Open the mapobservation + sensor5 817
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy35% within 1 km
≤100 m 97≤1 km 113≤10 km 264>10 km 120
594 georeferenced · 508 without coordinates
Open the institutions mapphysical evidence1 102
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 2 records without
Open the mapnot free-living2
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions41 of 77 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Moscow State Universitylocation not on record | 413 |
| LDlocation not on record | 43 |
| TROMlocation not on record | 42 |
| Helsinki, FI | 40 |
| Oulu, FI | 35 |
| Oskarshamn, SE | 29 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 28 |
| Museo Entomologico de Leonlocation not on record | 27 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 17 |
| SLU Artdatabankenlocation not on record | 17 |
| Zürich, CH | 15 |
| Glarus, CH | 15 |
| Bronx, US | 13 |
| Tartu, EE | 12 |
| Adam Mickiewicz University in Poznańlocation not on record | 12 |
| Olocation not on record | 11 |
| KMNlocation not on record | 9 |
| Tampere, FI | 9 |
| Wlocation not on record | 7 |
| Görlitz, DE | 6 |
| Karlsruhe, DE | 6 |
| Mlocation not on record | 6 |
| Uppsala, SE | 5 |
| Trondheim, NO | 5 |
| Bern, CH | 5 |
| BClocation not on record | 5 |
| BRNUlocation not on record | 5 |
| Whitehorse, CA | 4 |
| Uniwersytet Jagiellońskilocation not on record | 4 |
| Tromso University Museumlocation not on record | 4 |
| Philadelphia, US | 4 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 4 |
| Chongqing Museumlocation not on record | 4 |
| Denver, US | 4 |
| BDBClocation not on record | 3 |
| Zürich, CH | 3 |
| Victoria, CA | 3 |
| Finnish Museum of Natural Historylocation not on record | 3 |
| Saint Louis, US | 3 |
| Beijing, CN | 3 |
| Berlin, DE | 2 |
| B.A. Bennett Herbariumlocation not on record | 2 |
| Auckland, NZ | 2 |
| Fribourg, CH | 2 |
| Madison, US | 2 |
| Vitebsk State University named after P.M. Masherovlocation not on record | 2 |
| TUR-Alocation not on record | 2 |
| Tallinn, EE | 1 |
| Samara National Research Universitylocation not on record | 1 |
| NMBU:MINAlocation not on record | 1 |
| JBRJlocation not on record | 1 |
| Boise, US | 1 |
| Istituto Agrario Castelnuovolocation not on record | 1 |
| Coimbra, PT | 1 |
| Paris, FR | 1 |
| Ann Arbor, US | 1 |
| Porrentruy, CH | 1 |
| Turlock, US | 1 |
| Uniwersytet Opolskilocation not on record | 1 |
| Tampa, US | 1 |
| Uniwersytet Wrocławskilocation not on record | 1 |
| Jyväskylä, FI | 1 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 1 |
| Research Collection of B. A. Bennettlocation not on record | 1 |
| University of Stellenboschlocation not on record | 1 |
| Podgorica, ME | 1 |
| WINlocation not on record | 1 |
| Kuopio, FI | 1 |
| Natural History Museum, Tribhuvan Universitylocation not on record | 1 |
| Stockholm, SE | 1 |
| Armidale, AU | 1 |
| Canadian Department of Agriculturelocation not on record | 1 |
| Philadelphia, US | 1 |
| Turku, FI | 1 |
| St. Paul, US | 1 |
| University of Alberta Museumslocation not on record | 1 |
| Vancouver, CA | 1 |
77 institutions · 927 of 1 102 vouchered records shown · 169 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA10 detections
Where the DNA of Delphinium elatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found10
Studies independent surveys1
Countries3
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 10 detections have coordinates
Open the map3 countries0
Along cliffs overlooking the Mackenzie River…Growing across the road from any homes. Betw…
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median14.2 °C 8.40–17.1
Seasonal swing summer↔winter23.5 °C
Max temp (day)17.9 °C 9.90–21.1
Min temp (night)10.2 °C 5.00–13.3
Precipitation70.6 mm/mo 51.3–95.6
Air humidity61.1 % 56.4–64.2
Moisture balance-27.0 mm/mo -62.3–23.1
Vapour deficit658 Pa 423–771
Wind speed3.00 m/s 2.50–5.00
Cloud cover52.9 % 42.6–66.1
CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.