Delphinium denudatum

Wall. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ranunculales/Ranunculaceae/Delphinium

At a glance

Occurrence records7

Data sources9

Biological traits13

DNA specimens0

eDNA detections0

Sources9 archives

Databases and archives Delphinium denudatum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility7 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Chemical compositionLOTUS · NPASS50 compounds

Occurrence & distributionGBIF7 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 16

01Narrative

العائق المكتشف نوع نباتي ينتمي إلى جنس العائق من الفصيلة الحوذانية.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction5

Flowering endJul

Flowering startApr

Life formperennial

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Climatetemperate

Climberself-supporting

Elevation max3 000 m

Elevation min1 800 m

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

03Chemical composition50 compounds

Compounds documented for Delphinium denudatum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Terpenoid alkaloids19

Aporphine alkaloids $ Isoquinoline alkaloids11

Acyclic monoterpenoids4

Menthane monoterpenoids3

Menthane monoterpenoids $ Monocyclic monoterpenoids2

Documented compounds50 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Boldine	present	NPASS
(+)-Isodomesticine	present	NPASS
(-)-Isopulegol	present	NPASS
(-)-Linalool	present	NPASS
(1R,2S,3S,4S,5R,6S,8R,9R,10S,13R,16R,17S)-11-ethyl-6-methoxy-13-(methoxymethyl)-11-azahexacyclo[7.7.2.12,5.01,10.03,8.013,17]nonadecane-4,8,16-triol	present	LOTUS
(1S,2R,3R,4S,5S,6S,8S,9S,10R,13S,16S,17R)-11-ethyl-6-methoxy-13-(methoxymethyl)-11-azahexacyclo(7.7.2.12,5.01,10.03,8.013,17)nonadecane-4,8,16-triol	present	NPASS
(1S,5S,8R,9S,10S,11R,14R,16S,17R,18R,19R)-10,19-dihydroxy-5-methyl-12-methylidene-7-azaheptacyclo[9.6.2.01,8.05,17.07,16.09,14.014,18]nonadecan-3-one	present	LOTUS
(2R)-2-(2-hydroxypropan-2-yl)-5-methyl-3,4-dihydro-2H-oxepin-7-one	present	NPASS
(5,7-Dimethyl-12-methylidene-10,16-dioxo-7-azahexacyclo[9.6.2.01,8.05,17.09,14.014,18]nonadecan-3-yl) acetate	present	LOTUS
(L)-alpha-terpineol	present	NPASS

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Delphinium denudatum has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLPV364607.1 ↗154 228 bpPakistan

ACGT

AAGTAAATAGAAATTATAAAGAGGTCAGGAAAATAGGATGAGTAAAGTAAATCGAAATAGGATGGGCGAACGACGGGAATTGAACCCGCG …

Delphinium denudatum chloroplast, complete genome

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Delphinium denudatum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records16–322n range16median16mode11records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 169×CCDB · book-ipcn73-74 · CCDB · book-indian_vol1 · CCDB · DCDB-2016

CCDB · book-ipcn73-74 — KOUL, A.K., & R.N. GOHIL. 1973. Cytotaxonomical conspectus of the flora of Kashmir (1) Chromosome numbers of some common plants. Phyton (Horn) 15: 57-66.

CCDB · book-indian_vol1 — Mehra, P.N. & Kaur, B. 1963; Mehra, P.N. & Remanandan, P. 1972

CCDB · DCDB-2016 — Chakravarti, V. 2002. Vulnerable and threatened plants of economic value: Delphinium denudatum. MFP News 12(3): 22-23.

CCDB · DCDB-2016 — Jeelani, S. M., S. Kumari, R. C. Gupta, M. Abubakar & A. Siddique. 2014. Detailed cytomorphological investigations through male meiosis of polypetalous plants from the Kashmir Himalaya. Plant. Syst. Evol. 300: 1175–1198.

CCDB · DCDB-2016 — Koul, A. K. & R. N. Gohil. 1973. Cytotaxonomical conspectus of the flora of Kashmir (1). Chromosome numbers of some common plants. Phyton (Horn) 15: 57-66.

CCDB · DCDB-2016 — Kumar, P. & V. K. Singhal. 2013. Ethnobotany and ethnomedicinal uses, chromosomal status and natural propagation of some plants of Lahaul-Spiti and adjoining hills. J. Bot. 13: 1-14.

CCDB · DCDB-2016 — Mehra, P. N. & B. Kaur. 1963. Cytological study of some Himalayan Ranunculaceae. Proc. 50th Indian Sci. Congr., part 3: 453-454.

CCDB · DCDB-2016 — Rani, S., S. Kumari, R. C. Gupta & R. K. Chahota. 2014. Cytological studies of Angiosperms (174 species) from District Kangra, Himachal Pradesh (India). Plant Syst. Evol. 300(5): 851-862.

CCDB · DCDB-2016 — Zhukova, P. G. 1966. Chromosome numbers in some species of plants of the northeastern part of the U.S.S.R. Bot. Zhurn. (Moscow & Leningrad) 51: 1511-1516.

2n 322×CCDB · ipcn-api-dl · CCDB · DCDB-2016

CCDB · ipcn-api-dl — Al-kelidar, R. K. & A. J. Richards. 1981. Chromosomal indications of evolutionary trends in the genus Delphinium L. Cytologia 46: 623–633.

CCDB · DCDB-2016 — Al-Kelidar, R. K. & A. J. Richards. 1981. Chromosomal indications of evolutionary trends in the genus Delphinium L. Cytologia 46: 623-633.

n 85×CCDB · ipcn-api-dl · CCDB · DCDB-2016

CCDB · ipcn-api-dl — Jee, V., U. Dhar & P. Kachroo. 1989. Cytogeography of some endemic taxa of Kashmir Himalaya. Proc. Indian Natl. Sci. Acad., B 55: 177–184.

CCDB · DCDB-2016 — Jee, V., U. Dhar & P. Kachroo. 1983a. Chromosome numbers of some alpine-subalpine taxa of Kashmir Himalayas. Herba Hungarica 22(2): 23-31.

CCDB · DCDB-2016 — Jee, V., U. Dhar & P. Kachroo. 1989. Cytogeography of some endemic taxa of Kashmir Hymalaya. Proc. Indian Natl. Sci. Acad. Part B, Biol. Sci. 55:177-184.

CCDB · DCDB-2016 — Kumar, P. & V. K. Singhal. 2011. Chromosome number, male meiosis and pollen fertility in selected angiosperms of the cold deserts of Lahaul-Spiti and adjoining areas (Himachal Pradesh, India). Plant Syst. Evol. 297: 271-297.

CCDB · DCDB-2016 — Mehra, P. N. & P. Remanandan. 1972. Cytology of some Himalayan Ranunculaceae. Cytologia 37: 281-296.

n 102×CCDB · ipcn-api-dl · CCDB · DCDB-2016

CCDB · ipcn-api-dl — Sarkar, A. K., N. DATTA, U. Chatterjee & D. Hazra. 1982. In: IOPB chromosome number reports LXXVI. Taxon 31: 576–579.

CCDB · DCDB-2016 — Sarkar, A. K., N. Datta, U. Chatterjee & D. Hazra. 1982. In A. Löve (ed.) IOPB chromosome number reports LXXVI. Taxon 31(1): 576-579.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type7 records

Wild obs. + sensor3

Museum / vouchered4

Range

Area of Occupancy AOO28 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤1 km 2>10 km 1

3 georeferenced

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 4 records without

Open the institutions mapphysical evidence4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Dehra Dun, IN	4

1 institutions · 4 of 4 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)