Delphinium decorum

Fisch. & C.A.Mey. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ranunculales/Ranunculaceae/Delphinium

At a glance

Occurrence records267

Data sources10

Biological traits9

DNA specimens4

eDNA detections4

Sources10 archives

Databases and archives Delphinium decorum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility267 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF267 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 32

01Narrative

العائق المزين نوع نباتي ينتمي إلى جنس العائق من الفصيلة الحوذانية.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Delphinium decorum has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes1

GenBank sequences4

eDNA detections4

The DNA barcodea real sequence read deposited for this species

ITSAF258745.1 ↗604 bp

ACGT

GTCGAAACCTGCCCAGCAGAGCGACCCGCGAACGAGTGAAAACAAATCGGGACGGAACGGTTGGGAGCGTCCGCCCCTGANCGGCCGTCC …

Delphinium decorum variety 7 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete sequence; 5.8S ribosomal RNA gene, complete sequence; internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS4

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Delphinium decorum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 32 n = 16

Ploidypolyploid inferred

Chromosome records16–322n range32median32mode9records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 325×CCDB · book-ipcn67-71 · CCDB · book-fedorov · CCDB · Cave1956 +1

CCDB · book-ipcn67-71 — KURITA, M. 1957. Chromosome studies in Ranunculaceae v. Karyotypes of the subtribe Delphiniinae. Rep. Biol. Inst. Ehime Univ. 3: 1-8.

CCDB · book-fedorov — Kurita 1956d

CCDB · Cave1956 — Kurita b

CCDB · DCDB-2016 — Kurita, M. 1956. Cytological studies in Ranunculaceae, IX. Further note on the karyotypes of Delphinium and its allied genera. Jap. J. Genet. 31(6): 192-195.

CCDB · DCDB-2016 — Kurita, M. 1957. Chromosome studies in Ranunculaceae, V. Karyotypes of the subtribe Delphiniinae. Rep. Biol. Inst. Ehime Univ. 3: 1-8.

2n 164×CCDB · eflora · CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · eflora

CCDB · book-fedorov — Lewis H. et al. 1951

CCDB · book-fedorov — Lagro 1961

CCDB · book-atlas-flowering-plants — Lewis et al. 1951

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type267 records

Wild obs. + sensor162

Museum / vouchered105

Range

Area of Occupancy AOO508 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 97≤1 km 21≤10 km 3>10 km 13

134 georeferenced · 28 without coordinates

Open the mapobservation + sensor162

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy49% within 1 km

≤100 m 2≤1 km 36≤10 km 36>10 km 3

77 georeferenced · 28 without coordinates

Open the institutions mapphysical evidence105

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions23 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CASlocation not on record	16
Turlock, US	12
Angwin, US	8
Claremont, US	7
Fullerton, US	7
Corvallis, US	5
Pullman, US	5
Chongqing Museumlocation not on record	4
Davenport, US	3
San Diego, US	3
Santa Cruz, US	2
Davis, US	2
WTUlocation not on record	2
Riverside, US	2
San Francisco, US	2
San Luis Obispo, US	1
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	1
Bloomington, US	1
Bureau of Land Management, Medford District Officelocation not on record	1
Canadian Department of Agriculturelocation not on record	1
University of Stellenboschlocation not on record	1
Los Angeles, US	1
EL PASO, US	1
Ashland, US	1
Tampa, US	1
Bronx, US	1
San Jose, US	1
US	1
Arcata, US	1
Boise, US	1

30 institutions · 95 of 105 vouchered records shown · 10 without an institution code

09Environmental DNA4 detections

Where the DNA of Delphinium decorum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)