Delphinium carolinianum

Plantae/Tracheophyta/Magnoliopsida/Ranunculales/Ranunculaceae/Delphinium

At a glance

Occurrence records3 414

Data sources12

Biological traits22

DNA specimens3

eDNA detections9

Sources12 archives

Databases and archives Delphinium carolinianum's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 414 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources22 traits

Chemical compositionLOTUS5 compounds

Occurrence & distributionGBIF3 414 records

Environmental DNA1 datasets · 0 countries9 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 16

01Narrative

Delphinium carolinianum, commonly known as Carolina larkspur, is a species of perennial flowering plant in the buttercup family. It is native to central and eastern North America, where it is found in prairies and rocky glades. It produces blue to white flowers in the spring.Missouriplants D. carolinianum ssp. virescens Four subspecies have been named:Flora of North America D. carolinianum var. calciphilum - Native to cedar glades of the Southeastern United States D. carolinianum var. carolinianum - Widespread in central and eastern North America D. carolinianum var. vimineum - Native to coastal areas of the United States and Mexico D. carolinianum var. virescens - Native to the Central United States

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology5

Plant height0.526 m

Plant height generative0.72 m

Seed mass0.617 mg

⚠ sources differ — TRY: 0.617 mg · GIFT: 0.58 mg

Seed mass max0.64 mg

Seed mass min0.52 mg

Life cycle & reproduction4

Flowering endJun

Flowering startMay

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry6

Leaf C:N ratio173 g/g

Leaf c418 mg/g

Leaf dry-matter content (LDMC)137 mg/g

Leaf n28.5 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)13.21 mm²/mg

03Chemical composition5 compounds

Compounds documented for Delphinium carolinianum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Terpenoid alkaloids4

Flavonols1

Documented compounds5 total

Compound	Amount	Source
(1R,2S,3S,4S,5S,6S,8R,9S,10S,13S,16R,17R,18S)-11-ethyl-6,16,18-trimethoxy-13-(methoxymethyl)-11-azahexacyclo[7.7.2.12,5.01,10.03,8.013,17]nonadecane-2,4,8,9-tetrol	present	LOTUS
(1S,2R,3R,4S,5S,6S,8R,9S,10S,13S,16R,17R,18S)-11-ethyl-6,16,18-trimethoxy-13-(methoxymethyl)-11-azahexacyclo[7.7.2.12,5.01,10.03,8.013,17]nonadecane-4,8,9-triol	present	LOTUS
(1S,2S,3S,4S,5S,6S,8R,9R,10R,13R,16R,17S,18S)-11-ethyl-6,16,18-trimethoxy-13-(methoxymethyl)-11-azahexacyclo[7.7.2.12,5.01,10.03,8.013,17]nonadecane-2,4,8,9-tetrol	present	LOTUS
11-Ethyl-6,16,18-trimethoxy-13-(methoxymethyl)-11-azahexacyclo[7.7.2.12,5.01,10.03,8.013,17]nonadecane-2,4,8,9-tetrol	present	LOTUS
[(2R,3S,4R,5S,6S)-2-[(2R,3S,4R,5R,6S)-2-[2-(3,4-dihydroxyphenyl)-5-hydroxy-4-oxo-7-[(2S,3S,4S,5S,6R)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxychromen-3-yl]oxy-4,5-dihydroxy-6-(hydroxymethyl)oxan-3-yl]oxy-3,5-dihydroxy-6-(hydroxymethyl)oxan-4-yl] benzoate	present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Delphinium carolinianum has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences8

eDNA detections9

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMG235193.1 ↗309 bpUSA · 1937

ACGT

TGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCACTAGGTCGAGGGCACGCCTGCCTGGGCGTCACACACA …

Delphinium carolinianum subsp. virescens voucher CCDB-24918-D06 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK1rbcL2rbcLaITS5

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Delphinium carolinianum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records16–322n range16median16mode15records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 1610×CCDB · ipcn-api-dl · CCDB · eflora · CCDB · book-fedorov +1

CCDB · ipcn-api-dl — Löve, A. & D. Löve. 1982. In: IOPB chromosome number reports LXXIV. Taxon 31: 120–126.

CCDB · eflora

CCDB · book-fedorov — Gregory W. C. 1941

CCDB · book-fedorov — Turner (D. n. 1960)

CCDB · book-fedorov — Jackson (D. n. 1962)

CCDB · DCDB-2016 — Keener, C. S. 1976. Studies in the Ranunculaceae of the southern United States IV: Genera with zygomorphic flowers. Castanea 41: 12-20.

CCDB · DCDB-2016 — Löve, A. & D. Löve. 1982. In A. Löve (ed.) IOPB chromosome number reports LXXIV. Taxon 31: 120-126.

2n 325×CCDB · book-fedorov · CCDB · DCDB-2016

CCDB · book-fedorov — JleBHTCRHii: 1931B

CCDB · DCDB-2016 — Gregory, W. C. 1941. Phylogenetic and cytological studies in the Ranunculaceae. Trans. Amer. Phil. New Ser. 31: 443-520.

CCDB · DCDB-2016 — Lewitsky, G. A. 1931. Morphology of chromosomes and the conception of the karyotype in systematics (on the base of karyology of the subfamily Helleboreae). Trudy Prikl. Bot. Gen. Selektsii 27(1): 187-240.

CCDB · DCDB-2016 — Keener, C. S. 1976. Studies in the Ranunculaceae of the southern United States IV: Genera with zygomorphic flowers. Castanea 41: 12-20.

n 811×CCDB · ipcn-api-dl · CCDB · Cave1962 · CCDB · DCDB-2016

CCDB · ipcn-api-dl — Warnock, M. J. 1981. Biosystematics of the Delphinium carolinianum complex (Ranunculaceae). Syst. Bot. 6: 38–54.

CCDB · Cave1962 — Jackson 1962b

CCDB · DCDB-2016 — Warnock, M. J. 1981. Biosystematics of the Delphinium carolinianum Complex (Ranunculaceae). Syst. Bot. 6(1): 38-54.

CCDB · DCDB-2016 — Warnock, M. J. 1995. Documented chromosome reports and supplementary information on previously reported chromosome counts of North American Delphinium. Phytologia 18(2): 102-118.

CCDB · DCDB-2016 — Turner, B. L. 1960. Documented chromosome numbers of plants. Madroño 15: 219-221.

CCDB · DCDB-2016 — Gregory, W. C. 1941. Phylogenetic and cytological studies in the Ranunculaceae. Trans. Amer. Phil. New Ser. 31: 443-520.

CCDB · DCDB-2016 — Jackson, R. C. 1962. Documented chromosome numbers of plants. Madroño 16: 266-268.

n 164×CCDB · DCDB-2016

CCDB · DCDB-2016 — Warnock, M. J. 1981. Biosystematics of the Delphinium carolinianum Complex (Ranunculaceae). Syst. Bot. 6(1): 38-54.

CCDB · DCDB-2016 — Warnock, M. J. 1995. Documented chromosome reports and supplementary information on previously reported chromosome counts of North American Delphinium. Phytologia 18(2): 102-118.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type3 414 records

Wild obs. + sensor3 090

Museum / vouchered324

Origin

Native1

Range

Area of Occupancy AOO7 808 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 1 778≤1 km 311≤10 km 135>10 km 230

2 454 georeferenced · 636 without coordinates

Open the mapobservation + sensor3 090

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy37% within 1 km

≤100 m 23≤1 km 45≤10 km 83>10 km 31

182 georeferenced · 142 without coordinates

Open the institutions mapphysical evidence324

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions40 of 53 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Jena Microbial Resource Collectionlocation not on record	46
BAYLUlocation not on record	33
Fort Worth, US	30
Lubbock, US	28
Chongqing Museumlocation not on record	25
Jackson, US	16
EL PASO, US	13
Tuscaloosa, US	12
Bronx, US	11
Pittsburg, US	6
San Angelo, US	6
DOI/NPS, Colonial National Historical Parklocation not on record	5
US	5
Saint Louis, US	5
Denton, US	5
University of Southern Mississippilocation not on record	4
Austin, US	4
Bloomington, US	4
Tampa, US	4
St. Paul, US	3
Miami, US	3
University of Stellenboschlocation not on record	3
Riverside, US	3
Edmonton, CA	2
AUAlocation not on record	2
Dekalb, US	2
Wuzhou, CN	2
Stephenville, US	2
Emporia, US	2
Tennessee Technological Universitylocation not on record	2
Brookings, US	2
Denver, US	2
GAlocation not on record	2
Spearfish, US	2
Pullman, US	2
Tall Timbers Research Stationlocation not on record	2
DOI/NPS, Greenbelt Parklocation not on record	2
University of North Carolina at Pembrokelocation not on record	1
Mississippi State, US	1
GB	1
China Agricultural Universitylocation not on record	1
Waverly, US	1
Albuquerque, US	1
Jefferson City, US	1
Burlington, US	1
Mexico City, MX	1
Auckland, NZ	1
Philadelphia, US	1
Chapingo, MX	1
Fredericksburg, US	1
Davis, US	1
Knoxville, US	1
Phoenix, US	1

53 institutions · 318 of 324 vouchered records shown · 6 without an institution code

09Environmental DNA9 detections

Where the DNA of Delphinium carolinianum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map0 countries0

roadside grassy areamixed, principally oak woods. Occasionalvery sandy soilopen hillside. Dry open sandy pasture

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

At a glance

Sources12 archives

Size & morphology5

Life cycle & reproduction4

Diet & foraging1

Habitat & environment6

Physiology & chemistry6

Compound class profile2 classes

Documented compounds5 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type3 414 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions40 of 53 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type3 414 records