Delosperma echinatum

(Lam.) Schwantes · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Aizoaceae/Delosperma

At a glance

Occurrence records106

Data sources11

Biological traits14

DNA specimens5

eDNA detections4

Sources11 archives

Databases and archives Delosperma echinatum's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility106 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF106 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceCCDB2n = 54

01Narrative

Delosperma echinatum is a succulent plant, native to South Africa. It is also known as the pickle plant. The new genus Delosperma was erected by English botanist N. E. Brown in 1925, with this species later acknowledged as the type species. Scottish plant-hunter Francis Masson collected this species for Kew Gardens in 1774. French naturalist Jean-Baptiste Lamarck described it as Mesembryanthemum echinatum in 1786, from material in France that most likely had come from England. a flower on D. echinatum.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height max0.2 m

Plant height min0.1 m

Life cycle & reproduction2

Life formsucculent subshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max860 m

Elevation min150 m

Epiphyteterrestrial

Growth formshrub

Woodinessnon-woody

Other traits1

Plant support typefree-standing

03Chemical composition2 compounds

Compounds documented for Delosperma echinatum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Isoquinoline alkaloids $ Morphinan alkaloids1

Amarylidaceae alkaloids $ Isoquinoline alkaloids $ Morphinan alkaloids1

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Mesembrenone		present	LOTUS
Mesembrine		present	LOTUS

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Delosperma echinatum has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes5

GenBank sequences7

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSFN386504.1 ↗546 bp

ACGT

AACGACCCGTGAACACGTTTACAACACCCGGGAGGGACGCATGCGGCCTCGCGCCGCCTGCCCCCTCCCCACGCCGGGGGGCGCTCCTCG …

Delosperma echinatum ITS1 (partial), 5.8S rRNA gene and ITS2 (partial)

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★rbcLa★ITS5★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Delosperma echinatum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 54 n = 27

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 541×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — SHARMA, A.K., & S. GHOSH. 1968. Cytotaxonomy of Ficoideae. Cytologia 33: 439-452.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type106 records

Wild obs. + sensor77

Museum / vouchered28

Cultivated / captive1

Range

Area of Occupancy AOO268 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 33≤1 km 4≤10 km 2>10 km 10

49 georeferenced · 28 without coordinates

Open the mapobservation + sensor77

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤1 km 2≤10 km 2>10 km 1

5 georeferenced · 23 without coordinates

Open the institutions mapphysical evidence28

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Hamburglocation not on record	10
Pretoria, ZA	8
Zürich, CH	3
Chongqing Museumlocation not on record	2
Universidad de Nariño (UdeNar)location not on record	1
University of Johannesburglocation not on record	1
Saint Louis, US	1
Auckland, NZ	1
La Paz, BO	1

9 institutions · 28 of 28 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA4 detections

Where the DNA of Delosperma echinatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.8 °C 17.8–17.8

Seasonal swing summer↔winter6.60 °C

Max temp (day)21.2 °C

Min temp (night)14.4 °C

Precipitation50.1 mm/mo

Air humidity59.7 %

Moisture balance-94.4 mm/mo

Vapour deficit816 Pa

Wind speed4.90 m/s

Cloud cover21.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)