Delonix regia
(Bojer ex Hook.) Raf. · speciesAt a glance
Occurrence records24 290
Data sources17
Biological traits133
DNA specimens28
eDNA detections15
Sources17 archives
Databases and archives Delonix regia's data was compiled from.
WikipediaWikimedia Foundation21 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility24 271 records↗
OBISOcean Biodiversity Information System19 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics28 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources133 traits
Chemical compositionLOTUS · NPASS27 compounds
Occurrence & distributionGBIF · OBIS24 290 records
Environmental DNA1 datasets · 4 countries15 detections
DNA & barcodingBOLD · NCBI28 specimens
Genome at a glanceCCDB · GIFT · GoaT≈580 Mbp
01Narrative
Delonix regia is a species of flowering plant in the bean family Fabaceae, subfamily Caesalpinioideae native to Madagascar. It is noted for its fern-like leaves and flamboyant display of orange-red flowers over summer. In many tropical parts of the world it is grown as an ornamental tree and in English it is given the name royal poinciana, flamboyant, phoenix flower, flame of the forest, or flame tree (one of several species given this name). This species was previously placed in the genus Poinciana, named for Phillippe de Longvilliers de Poincy, the 17th-century governor of Saint Christopher (Saint Kitts). It is a non-nodulating legume.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTAusTraitsUSDATRY
Size & morphology25
Fruit length400 mm
Fruit length max700 mm
Fruit length min200 mm
Fruit width45 mm
Fruit width max70 mm
Fruit width min30 mm
Leaf length16.5 mm
Leaf length max600 mm
Leaf length min5 mm
Leaf width3 mm
Leaf width max5 mm
Leaf width min2 mm
Petiole length3 cm
Plant height15 m
⚠ sources differ — GIFT: 15 m · AusTraits: 11 m · USDA: 15.24 m · TRY: 15.24 m
Plant height max15 m
Plant height min5 m
Seed length19.5 mm
Seed length max25 mm
Seed length min20 mm
Seed mass400 mg
⚠ sources differ — TRY: 400 mg · GIFT: 456 mg
Seed mass max482 mg
Seed mass min326 mg
Seed width7 mm
Seed width max8 mm
Seed width min6 mm
Life cycle & reproduction29
Bloom periodEarly Summer
Coppice potentialNo
Deciduousnessvariable
⚠ sources differ — TRY: deciduous/evergreen · GIFT: evergreen
Dehiscencedehiscent
Dispersal type detailedanthropochorous
Flower colourred
⚠ sources differ — GIFT: red · USDA: Orange
Flower conspicuousYes
Flowering timeynnnnnnnnnyy
Fruit seed period beginYear Round
Fruit seed period endYear Round
Growth rate USDARapid
Life formtree
Life spanperennial
Lifespan categoryModerate
Pollination modebiotic
Pollination syndromeinsect
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerYes
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formphanerophyte
Resprout abilityYes
Seed spread rateModerate
Vegetative spread rateSlow
Diet & foraging1
Parasiteindependent
Habitat & environment34
Active growth periodYear Round
Adapted to coarse textured soilsYes
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climateseasonally dry tropical
Climberself-supporting
Elevation max1 540 m
Elevation mean275 m
Elevation min0 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerDense
Foliage porosity winterPorous
Foliage textureFine
Fruit colourblack
Fruit fleshinessdry
Fruit typelegume
Growth formtree
Growth form USDAMultiple Stem
Habitat GIFTÁrea Antrópica
Hedge toleranceLow
Known allelopathNo
Leaf compoundnesscompound
Leaf retentionNo
Leaf shapeoblong
Low growing grassNo
Mycorrhiza typearbuscular
Root depth min60 in
Shape and orientationSemi-Erect
Small grainNo
Succulenceno
Woodinesswoody
Physiology & chemistry22
Anaerobic toleranceLow
C:N ratioHigh
Caco3 toleranceMedium
Cold stratification requiredNo
Drought toleranceMedium
Fertility requirementLow
Fire resistantNo
Fire toleranceNone
Frost free days min365 days
Leaf n16.5 mg/g
Moisture useMedium
Nitrogen fixation levelLow
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Precipitation max100 in
Precipitation min40 in
Salinity toleranceMedium
Shade toleranceMedium
Soil pH max7 pH
Soil pH min4 pH
Temperature min31 °F
Wood density689 mg/cm³
⚠ sources differ — TRY: 689 mg/cm³ · GIFT: 519 mg/cm³
Uses & economy14
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productNo
Fuelwood productMedium
Lumber productNo
Naval store productNo
Nursery stock productYes
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound900 per lb
ToxicityNone
Veneer productNo
Other traits8
Fall conspicuousNo
Fruit seed abundanceHigh
Fruit seed conspicuousYes
Fruit seed persistenceNo
Height at 20yr15.24 m
Planting density max300 per acre
Planting density min170 per acre
Seeds per fruit11-100
03Chemical composition27 compounds
Compounds documented for Delonix regia across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Unsaturated fatty acids3
Aminoacids3
Branched fatty acids $ Unsaturated fatty acids2
Carbocyclic fatty acids2
Anthocyanidins1
Documented compounds27 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (2S,3S)-3-hydroxypyrrolidinium-2-carboxylate | present | LOTUS | |
| (S)-2-Azetidinecarboxylic acid | present | NPASS | |
| (s)-Azetidine-2-carboxylate | present | LOTUS | |
| 1-(1-Butenyl)-2,5-cycloheptadiene | present | NPASS | |
| 2-[[2-(3,4-dihydroxyphenyl)-5,7-dihydroxy-3,4-dihydro-2H-chromen-3-yl]oxy]-2-(4-hydroxyphenyl)-3,4-dihydrochromene-3,4,5,7-tetrol | present | LOTUS | |
| 3-O-Acetyloleanolic Acid | present | LOTUS | |
| [(3R,5Z,8Z)-undeca-1,5,8-trien-3-yl] acetate | present | NPASS | |
| BRHODWILXVSFKE-VMPITWQZSA-N | present | NPASS | |
| Cubenol | present | NPASS | |
| Cyclopropane, (R,R)-1-((Z)-hex-1'-enyl)-2-ethenyl- | present | NPASS |
05DNA & barcoding28 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Delonix regia has left across the world's sequence archives.
At a glance
DNA specimens28
Marker genes7
GenBank sequences10
eDNA detections15
Countries6
The DNA barcodea real sequence read deposited for this species
TGTAGAATCTCATGAACCATCGAGTCTTTGAACGCAAGGTGCACCTGAAGCCCTCACCTGAGGGCACGCCTACCTGGGCATCACACAACG …
Delonix regia voucher US:Gostel724 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK3★rbcL6★rbcLa★ITS1★ITS2trnH-psbA
animal barcodeplant barcodefungal barcodemarker
06Genome at a glanceCCDB · GIFT · GoaT · NCBI
The complete instruction manual Delonix regia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size≈580 479 956 bp assembly estimate
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Delonix regia0.58 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 28 n = 14
Ploidy2× diploid · measured
Chromosome records24–282n range28median28mode17records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2814×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 · CCDB · book-indian_vol1 +3
CCDB · ipcn-api-dl — Huang, S. f., Z. f. Zhao, Z. y. Chen, S. j. Chen & X. x. Huang. 1989. Chromosome counts on one hundred species and infraspecific taxa. Acta Bot. Austro Sin. 5: 161–176.
CCDB · ipcn-api-dl — Choudhary, P. & S. S. Choudhary. 1988. Karyotypic studies and trend of speciation in some species of Caesalpiniaceae. J. Cytol. Genet. 23: 183–189.
CCDB · ipcn-api-dl — Kumari, S. & S. S. Bir. 1989. Karyomorphological evolution in Caesalpiniaceae. J. Cytol. Genet. 24: 149–163.
CCDB · ipcn-api-dl — Jarolĭmovă. 1994. Chromosome counts of some Cuban angiosperms. Folia Geobot. Phytotax. 29: 101–106.
CCDB · ipcn-api-dl — Bir, S. S. & S. Kumari. 1979. Cytological evolution of the leguminous flora of the Punjab plain. Recent Res. Pl. Sci. (New Delhi). 7: 252–260.
CCDB · ipcn-api-dl — Sanjappa, M. 1978. In IOPB chromosome number reports LXI. Taxon 27: 375–392.
CCDB · book-ipcn75-78 — Sanjappa 1978
CCDB · book-indian_vol1 — Jacob, K.T. 1940 ; Atchison, E. 1951 ; Berger, C.A. et al. 1958 ; Roy, R.P. & Jha, R.P. 1960b; Mehra, P.N. & Sareen, T.S. 1973a ; Sanjappa, M. 1978 ; Bir, S.S. & Kumari, S. 1980
CCDB · book-fedorov — Jacob 1940
CCDB · book-fedorov — Atchison 1951
CCDB · book-fedorov — Berger C. A. et al. 1958
CCDB · book-atlas-flowering-plants — Jacob 1940,
CCDB · book-atlas-flowering-plants — Atchison 1951
GIFT · GIFT (floras)
2n 243×CCDB · book-indian_vol1 · CCDB · book-fedorov · GIFT · GIFT (floras)
CCDB · book-indian_vol1 — Poucques, M.L. de 1945a
CCDB · book-fedorov — Poucques 1945a
GIFT · GIFT (floras)
n 148×CCDB · book-ipcn65 · CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 +2
CCDB · book-ipcn65 — Tixier 1965
CCDB · ipcn-api-dl — Gill, L. S. & S. W. Husaini. 1982. Cytology of some arborescent Leguminosae of Nigeria. Silvae Genet. 31: 117–122.
CCDB · ipcn-api-dl — Choudhary, P. & S. S. Choudhary. 1989. Meiotic studies for determination of taxonomic relatedness in some taxa of the Caesalpiniaceae (Fabaceae). Kromosomo 54: 1787–1792.
CCDB · ipcn-api-dl — Bir, S. S. & S. Kumari. 1979. Cytological evolution of the leguminous flora of the Punjab plain. Recent Res. Pl. Sci. (New Delhi). 7: 252–260.
CCDB · ipcn-api-dl — Mehra, P. N. 1976. Cytology of Himalayan Hardwoods. Sree Saraswaty Press, Calcutta.
CCDB · book-ipcn75-78 — Mehra 1976
CCDB · book-ipcn73-74 — MEHRA, P.N., & T.S. SAREEN. 1973. Cytological observations on arborescent Leguminosae of the western Himalayas. Nucleus 16: 20-24.
CCDB · Cannon, 2015 — Bir, S. S. & S. Kumari., 1979
n 121×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Singhal, V. K., B. S. Gill & M. S. Sidhu. 1990. Cytological explorations of Indian woody legumes. Proc. Indian Acad. Sci., Pl. Sci. 100: 319–331.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GIFT · GIFT (floras)
GIFT · GIFT (floras)
polyploid inferred1×PloiDB · family-scale
PloiDB · family-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
07Deep time~19.2 Ma lineage
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
DNA clock origin19.2 Ma TimeTree
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.
DNA clock origin
08Occurrence & distribution
Record type24 290 records
Wild obs. + sensor22 597
Museum / vouchered1 604
Cultivated / captive13
Other76
Origin
Native3
Introduced1 352
Range
Area of Occupancy AOO31 820 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy74% within 1 km
≤100 m 4 467≤1 km 1 356≤10 km 1 761>10 km 324
7 908 georeferenced · 14 689 without coordinates
Open the mapobservation + sensor22 597
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy79% within 1 km
≤100 m 239≤1 km 50≤10 km 57>10 km 19
365 georeferenced · 1 239 without coordinates
Open the institutions mapphysical evidence1 604
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 13 records without
Open the mapnot free-living13
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions126 of 274 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Durango, MX | 118 |
| Saint Louis, US | 117 |
| Paris, FR | 88 |
| Mexico City, MX | 44 |
| Kew, GB | 39 |
| Bronx, US | 37 |
| Beijing, CN | 24 |
| Plocation not on record | 23 |
| Mérida, MX | 22 |
| Brisbane, AU | 22 |
| Kunming, CN | 22 |
| Tampa, US | 21 |
| Puerto Ayora, EC | 19 |
| University of Stellenboschlocation not on record | 18 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 18 |
| National Biodiversity Institute, Costa Ricalocation not on record | 17 |
| MeiseBGlocation not on record | 16 |
| Guangzhou, CN | 15 |
| Canberra, AU | 13 |
| Universidad de Antioquia (UdeA)location not on record | 13 |
| Smithfield, AU | 13 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 12 |
| Centre National d'Application des Recherches Pharmaceutiques (CNARP)location not on record | 12 |
| Laboratorio de Ictiologialocation not on record | 11 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 11 |
| Antiguo Cuscatlán, SV | 11 |
| Miami, US | 10 |
| CNF-UFHBlocation not on record | 10 |
| Zapopan, MX | 10 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 10 |
| Mexico City, MX | 10 |
| Pretoria, ZA | 10 |
| Zhengzhou, CN | 10 |
| Palmerston, AU | 10 |
| San Francisco de Campeche, MX | 9 |
| UNIVASFlocation not on record | 9 |
| Cascavel, BR | 9 |
| LDlocation not on record | 9 |
| UEMlocation not on record | 8 |
| Austin, US | 8 |
| Berlin, DE | 8 |
| Honolulu, US | 8 |
| Baroda, IN | 7 |
| Chengdu, CN | 7 |
| Riverside, US | 7 |
| Universidad de La Salle (La Salle)location not on record | 7 |
| Adam Mickiewicz University in Poznańlocation not on record | 7 |
| Taipei, TW | 7 |
| Chaguaramas, TT | 7 |
| UNESP-FCAVlocation not on record | 7 |
| IBANNlocation not on record | 7 |
| Museo Nacional de Costa Rica (MNCR)location not on record | 6 |
| Giardini Botanici Hanburylocation not on record | 6 |
| Tlalnepantla, MX | 6 |
| Tapachula, MX | 6 |
| Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record | 6 |
| WAGlocation not on record | 6 |
| BISHlocation not on record | 6 |
| Guatemala, GT | 6 |
| Departamento de Sistematica e Ecologialocation not on record | 6 |
| Chapingo, MX | 6 |
| Altos de Pipe, VE | 6 |
| Istituto Agrario Castelnuovolocation not on record | 6 |
| UFRRJlocation not on record | 6 |
| Ilhéus, BR | 6 |
| Masindi, UG | 5 |
| Ann Arbor, US | 5 |
| Southwest Forestry Collegelocation not on record | 5 |
| San José, CR | 5 |
| UEMAlocation not on record | 5 |
| Universidade Federal do Maranhãolocation not on record | 5 |
| Montréal, CA | 5 |
| Museo Entomologico de Leonlocation not on record | 5 |
| CEPLAClocation not on record | 4 |
| Maringá, BR | 4 |
| Guilin, CN | 4 |
| Christchurch, NZ | 4 |
| Mount Annan, AU | 4 |
| Foz do Iguaçu, BR | 4 |
| JBRJlocation not on record | 4 |
| Universidade Federal de Sergipe (UFS)location not on record | 4 |
| UESBlocation not on record | 4 |
| Ivano-Frankivsk, UA | 4 |
| Auckland, NZ | 4 |
| Universidad Nacional Autónoma de Honduraslocation not on record | 4 |
| HUAlocation not on record | 4 |
| HNBlocation not on record | 4 |
| CJBGlocation not on record | 4 |
| Mérida, MX | 4 |
| CASlocation not on record | 4 |
| Centre de Recherche en Sciences Naturelles (CRSN/Lwiro)location not on record | 4 |
| Jardín Botánico de Cartagena "Guillermo Piñeres" (JBC)location not on record | 4 |
| Edinburgh, GB | 4 |
| Montecillo, Texcoco, MX | 4 |
| Bloomington, US | 4 |
| Bangkok, TH | 4 |
| UFMSlocation not on record | 4 |
| Fortaleza, BR | 3 |
| Sri Ramaswamy Memorial Universitylocation not on record | 3 |
| MEXUlocation not on record | 3 |
| Uppsala, SE | 3 |
| Glocation not on record | 3 |
| Salvador, BR | 3 |
| Durban, ZA | 3 |
| Xishuangbanna Tropical Botanical Garden, Academia Sinicalocation not on record | 3 |
| Chongqing Museumlocation not on record | 3 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 3 |
| Mexico City, MX | 3 |
| UFRPElocation not on record | 3 |
| Universidad Nacional de Colombia (UNAL)location not on record | 3 |
| HUENFlocation not on record | 3 |
| EL PASO, US | 3 |
| UNICAMPlocation not on record | 3 |
| Kensington, AU | 3 |
| UNEMATlocation not on record | 3 |
| Porto Alegre, BR | 3 |
| Xiamen, CN | 3 |
| Universidade Federal do Vale do São Franciscolocation not on record | 3 |
| UnBlocation not on record | 3 |
| Eduardo Mondlane Universitylocation not on record | 3 |
| ASUlocation not on record | 3 |
| St. Augustine, TT | 3 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 3 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 3 |
| Claremont, US | 2 |
| Wuzhou, CN | 2 |
| USP-IBlocation not on record | 2 |
| TAFORI-LSRClocation not on record | 2 |
| INBIOlocation not on record | 2 |
| Universidade Federal do Oeste da Bahialocation not on record | 2 |
| Torreón, MX | 2 |
| FUNEDlocation not on record | 2 |
| UFMGlocation not on record | 2 |
| Cuiabá, BR | 2 |
| San Isidro, AR | 2 |
| UFPElocation not on record | 2 |
| UTFPR-CPlocation not on record | 2 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 2 |
| REALlocation not on record | 2 |
| Santiago de Cali, CO | 2 |
| Chicago, US | 2 |
| Universidad Industrial de Santander (UIS)location not on record | 2 |
| Feira de Santana, BR | 2 |
| Brussels, BE | 2 |
| LSF/FSA/UAClocation not on record | 2 |
| Philadelphia, US | 2 |
| Instituto de Investigação Científica Tropicallocation not on record | 2 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 2 |
| Pondicherry, IN | 2 |
| UNESP-FCAlocation not on record | 2 |
| Toluca, MX | 2 |
| Guangzhou, CN | 2 |
| Blumenau, BR | 2 |
| Guiyang, CN | 2 |
| MAlocation not on record | 2 |
| University of Arizona, Laboratory of Tree-Ring Researchlocation not on record | 2 |
| Smithsonian Institution, National Museum of Natural Historylocation not on record | 2 |
| QCNElocation not on record | 2 |
| Leiden University Medical Centerlocation not on record | 2 |
| Centre National de la Recherche Appliquée au Developement Rurallocation not on record | 2 |
| FLASlocation not on record | 2 |
| Santa Cruz de la Sierra, BO | 2 |
| Jinghong, CN | 2 |
| Forest Herbarium Ibadan (FHI)location not on record | 2 |
| Paleontological Collectionlocation not on record | 2 |
| PUC-RSlocation not on record | 2 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 1 |
| Ural Federal University "B. N. Yeltsin"location not on record | 1 |
| HAWlocation not on record | 1 |
| Facultad de Zootecnia y Ecología, Universidad Autónoma de Chihuahualocation not on record | 1 |
| Wlocation not on record | 1 |
| Sangmiung Universitylocation not on record | 1 |
| Armidale, AU | 1 |
| Odawara, JP | 1 |
| Ciudad de México, MX | 1 |
| Canadian Department of Agriculturelocation not on record | 1 |
| Department of Earth and Environmental Sciences, Yarmouk Universitylocation not on record | 1 |
| Universiti Sains Malaysialocation not on record | 1 |
| Aarhus, DK | 1 |
| Port Elizabeth Museum (Bayworld)location not on record | 1 |
| Cusco, PE | 1 |
| Herbario Selva Central Oxapampa - estación biológica del Jardín Botánico de Missourilocation not on record | 1 |
| XALlocation not on record | 1 |
| Universidad Nacional de Asunciónlocation not on record | 1 |
| Culiacán, MX | 1 |
| Autlán de Navarro, MX | 1 |
| Mexico City, MX | 1 |
| Universidad de los Llanos (UniLlanos)location not on record | 1 |
| La Paz, BO | 1 |
| CMULlocation not on record | 1 |
| INIREBlocation not on record | 1 |
| Durham, US | 1 |
| San Diego, US | 1 |
| Museu Paraense Emílio Goeldilocation not on record | 1 |
| HUT Culture Collectionlocation not on record | 1 |
| Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record | 1 |
| Ojo, NG | 1 |
| Wuhan, CN | 1 |
| Pontifícia Universidade Católica do Paranálocation not on record | 1 |
| Universidad Distrital Francisco José de Caldas (UDistrital)location not on record | 1 |
| Tuxtla Gutiérrez, MX | 1 |
| Nishihara, JP | 1 |
| Iquitos, PE | 1 |
| Conservatoire Botanique National de Mascarinlocation not on record | 1 |
| QAUlocation not on record | 1 |
| McWane Science Centerlocation not on record | 1 |
| Universidad Nacional Agrarialocation not on record | 1 |
| Knox Collegelocation not on record | 1 |
| Centro de Estudios y Colecciones Biológicas para la Conservaciónlocation not on record | 1 |
| Jataí / Setor Industrial, BR | 1 |
| León, NI | 1 |
| GB | 1 |
| Criciúma, BR | 1 |
| Mazatlán, MX | 1 |
| Phoenix, US | 1 |
| UTPLlocation not on record | 1 |
| Universidad Tecnológica del Chocó (UTCH)location not on record | 1 |
| Centre National de la Recherche Scientifique et Technologique / Institut de l'environnement et de recherches agricoleslocation not on record | 1 |
| TNMlocation not on record | 1 |
| Seropédica, BR | 1 |
| Departamento de Madera, Celulosa y Papel, Centro Universitario de Ciencias Exactas e Ingenierías, Universidad de Guadalajaralocation not on record | 1 |
| BAYLUlocation not on record | 1 |
| BMlocation not on record | 1 |
| Gump Stationlocation not on record | 1 |
| Beijing, CN | 1 |
| Nanjing, CN | 1 |
| Emporia, US | 1 |
| Institut fur Allgemeine Mikrobiologielocation not on record | 1 |
| Vancouver, CA | 1 |
| Gujarat Biodiversity Gene Banklocation not on record | 1 |
| Université du Lomélocation not on record | 1 |
| Cape Town, ZA | 1 |
| Riobamba, EC | 1 |
| Fredericksburg, US | 1 |
| UFBAlocation not on record | 1 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 1 |
| NO DISPONIBLElocation not on record | 1 |
| Alexandria Universitylocation not on record | 1 |
| Entomological Society of Latvialocation not on record | 1 |
| UTFPR-DVlocation not on record | 1 |
| Hudson, US | 1 |
| Campo Mourão, BR | 1 |
| Natural History Museum, Tribhuvan Universitylocation not on record | 1 |
| UNESClocation not on record | 1 |
| UEPAlocation not on record | 1 |
| Fort Worth, US | 1 |
| Brasília, BR | 1 |
| Denver, US | 1 |
| University of Hargeisalocation not on record | 1 |
| RJBJCIlocation not on record | 1 |
| Stockholm, SE | 1 |
| UNICAPlocation not on record | 1 |
| Lake Charles, US | 1 |
| Yaoundé, CM | 1 |
| James Cook Townsvillelocation not on record | 1 |
| UNIVILLElocation not on record | 1 |
| UNESP-RClocation not on record | 1 |
| Museum of Zoologylocation not on record | 1 |
| Museo naturalistico del Frignano Ferruccio Minghellilocation not on record | 1 |
| MSB-2797location not on record | 1 |
| UFVJMlocation not on record | 1 |
| URCAlocation not on record | 1 |
| IPA/SPlocation not on record | 1 |
| Uberlândia, BR | 1 |
| Chinese Academy of Forestrylocation not on record | 1 |
| UNESP-ISlocation not on record | 1 |
| Millersville, US | 1 |
| Columbia, US | 1 |
| St. Paul, US | 1 |
| National Museum of Natural Sciencelocation not on record | 1 |
| Cruz das Almas, BR | 1 |
| Toronto, CA | 1 |
| Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record | 1 |
| Zacatecas, MX | 1 |
274 institutions · 1 480 of 1 604 vouchered records shown · 105 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA15 detections
Where the DNA of Delonix regia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found15
Studies independent surveys1
Countries4
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 15 detections have coordinates
Open the map4 countries0
Side of road
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median25.1 °C 23.6–27.7
Seasonal swing summer↔winter16.5 °C
Max temp (day)30.5 °C 27.2–31.3
Min temp (night)19.3 °C 19.2–24.0
Precipitation109 mm/mo 65.3–139
Air humidity57.0 % 52.0–63.4
Moisture balance-17.8 mm/mo
Vapour deficit1,610 Pa 1,142–1,616
Wind speed2.60 m/s
Cloud cover25.2 % 8.00–33.4
CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.