Delisea pulchra

(Grev.) Mont. · species

image placeholder — illustration coming later

Plantae/Rhodophyta/Florideophyceae/Bonnemaisoniales/Bonnemaisoniaceae/Delisea

At a glance

Occurrence records2 582

Data sources11

Biological traits2

DNA specimens13

eDNA detections162

Sources11 archives

Databases and archives Delisea pulchra's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility1 044 records↗

OBISOcean Biodiversity Information System1 538 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI162 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Chemical compositionLOTUS · NPASS65 compounds

Occurrence & distributionGBIF · OBIS2 582 records

Environmental DNA1 datasets · 1 countries162 detections

DNA & barcodingBOLD · NCBI13 specimens

Genome at a glanceGoaT · NCBI≈303 Mbp

01Narrative

Delisea pulchra is a red algae found in Southern Australia, New Zealand, the Subantarctic Islands and the Antarctic Peninsula. It produces a range of secondary metabolites called halogenated furanones that have ecological roles as defenses against epiphytes and herbivores.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonesessile

03Chemical composition65 compounds

Compounds documented for Delisea pulchra across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Fatty alcohols4

Arylnaphthalene and aryltetralin lignans4

Oxygenated hydrocarbons4

Ecdysteroids2

Halogenated hydrocarbons1

Documented compounds65 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,2R,3R,5S,9R,10R,13R,14S,17S)-1,2,3,14-tetrahydroxy-10,13-dimethyl-17-[(2R,3R)-2,3,6-trihydroxy-6-methylheptan-2-yl]-2,3,4,5,9,11,12,15,16,17-decahydro-1H-cyclopenta[a]phenanthren-6-one	present	NPASS
(2R,3S,4S,5R,6R)-2-(hydroxymethyl)-6-[(E,1S)-3-[(1R,3S,6S)-3-hydroxy-1,5,5-trimethyl-7-oxabicyclo[4.1.0]heptan-6-yl]-1-methyl-allyloxy]tetrahydropyran-3,4,5-triol	present	NPASS
(2R,3S,4S,5R,6S)-2-(hydroxymethyl)-6-(4-((2S,3R)-3-(hydroxymethyl)-5-((E)-3-hydroxyprop-1-enyl)-7-methoxy-2,3-dihydro-1-benzofuran-2-yl)-2-methoxyphenoxy)oxane-3,4,5-triol	present	NPASS
(5E)-4-bromo-3-[(1R)-1-hydroxybutyl]-5-(iodomethylidene)furan-2-one	present	LOTUS
(5E)-4-bromo-5-(chloromethylidene)-3-[(1R)-1-hydroxybutyl]furan-2-one	present	LOTUS
(5R)-4-bromo-3-[(1R)-1-hydroxybutyl]-5-(iodomethyl)-5-methoxyfuran-2-one	present	LOTUS
(5R)-4-bromo-3-butyl-5-(dibromomethyl)-5-hydroxyfuran-2-one	present	LOTUS
(5R)-4-bromo-3-butyl-5-(dibromomethyl)-5-methoxyfuran-2-one	present	LOTUS
(5R)-4-bromo-5-hydroxy-3-[(1R)-1-hydroxybutyl]-5-methylfuran-2-one	present	LOTUS
(5S)-4-bromo-3-[(1R)-1-hydroxybutyl]-5-(iodomethyl)-5-methoxyfuran-2-one	present	LOTUS

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Delisea pulchra has left across the world's sequence archives.

At a glance

DNA specimens13

BINs2

Marker genes3

GenBank sequences5

eDNA detections162

The DNA barcodea real sequence read deposited for this species

rbcLKY987602.1 ↗643 bpAntarctica

ACGT

GATTCCGTGTAACTCCACAACCAGGAGTTGACCCTGGGCTTCTGCTGCTATTGCAGGTGAATCATCTACAGCAACTTGGACAGTAGTTTG …

Delisea pulchra ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Delisea hypneoidessame genus8.0%Asparagopsis armatasame family14.1%Sonderophycus fervenssame order14.2%Ozophora lanceolatasame order14.5%Sphaerococcus coronopifoliussame order14.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★rbcL528S-D2

animal barcodeplant barcodemarker

06Genome at a glanceGoaT · NCBI

The complete instruction manual Delisea pulchra carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈302 725 288 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Delisea pulchra0.30 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelContig

08Occurrence & distribution

Record type2 582 records

Wild obs. + sensor1 363

Museum / vouchered1 179

Other40

Origin

Native32

Range

Area of Occupancy AOO1 700 km²

Depth

0–200 m sunlit169

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 10 m · max 100 m · 169 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy99% within 1 km

≤100 m 1 277≤1 km 36≤10 km 19

1 332 georeferenced · 31 without coordinates

Open the mapobservation + sensor1 363

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy31% within 1 km

≤100 m 68≤1 km 85≤10 km 315>10 km 29

497 georeferenced · 682 without coordinates

Open the institutions mapphysical evidence1 179

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions19 of 32 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adelaide, AU	226
National Marine Biodiversity Institute of Korealocation not on record	110
Museo Entomologico de Leonlocation not on record	78
Wellington, NZ	32
Mount Annan, AU	27
Brisbane, AU	25
Hobart, AU	24
Kensington, AU	23
National Institute of Biological Resourceslocation not on record	13
Ann Arbor, US	11
University of Stellenboschlocation not on record	11
Auckland, NZ	10
LDlocation not on record	7
Chapel Hill, US	7
Bronx, US	7
MeiseBGlocation not on record	3
Natick, US	3
PHlocation not on record	2
Canberra, AU	2
Christchurch, NZ	2
WTUlocation not on record	2
Vancouver, CA	2
Buenos Aires, AR	2
South Kensington, GB	1
Honolulu, US	1
Australian Institute of Marine Sciencelocation not on record	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Durham, US	1
GRAlocation not on record	1
IPA/SPlocation not on record	1
Durham, US	1
James Cook Townsvillelocation not on record	1

32 institutions · 638 of 1 179 vouchered records shown · 192 without an institution code

09Environmental DNA162 detections

Where the DNA of Delisea pulchra was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found162

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 162 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

Temperature19.6 °C 14.0–31.5

pH8.19 7.75–8.41

Conductivity48,500 µS/cm 43,599–58,672

Salinity35.7 PSU 33.0–36.2

Dissolved oxygen7.36 mg/L 5.47–8.24

Turbidity0.197 NTU 0.057–0.788

Nitrate0.5 µmol/L 0.1–8.80

Depth2.00 m 0–100

PelagicSedimentCoastal water

150 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.8 °C 14.6–22.1

Seasonal swing summer↔winter8.10 °C

Max temp (day)20.2 °C 16.5–23.5

Min temp (night)17.4 °C 12.4–20.8

Precipitation80.1 mm/mo 13.9–126

Air humidity57.5 % 56.1–61.8

Moisture balance17.5 mm/mo

Vapour deficit918 Pa 717–1,145

Wind speed6.10 m/s

Cloud cover21.4 % 10.6–27.2

CHELSA 1981–2010, ~9 km grid, at location & month of 162 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Delisea pulchra

At a glance

Sources11 archives

Habitat & environment2

Compound class profile5 classes

Documented compounds65 total

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type2 582 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions19 of 32 geolocated

Signal

Where its DNA was found

How strong is each trace?

Measured at samplingin-field

Modelled climatemodelled

Record type2 582 records