Delia antiqua

(Meigen, 1826) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Anthomyiidae/Delia

At a glance

Occurrence records245

Data sources8

Biological traits0

DNA specimens106

eDNA detections95

Sources8 archives

Databases and archives Delia antiqua's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility245 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI95 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics106 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome ~0.71 Gbp↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF245 records

Environmental DNA1 datasets · 2 countries95 detections

DNA & barcodingBOLD106 specimens

Genome at a glanceGoaT714 Mbp

01Narrative

Delia antiqua, commonly known as the onion fly, is a cosmopolitan pest of crops. The larvae or maggots feed on onions, garlic, and other bulbous plants.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding106 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Delia antiqua has left across the world's sequence archives.

At a glance

DNA specimens106

BINs2

Marker genes11

eDNA detections95

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus90 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 1 variable positions, in barcode order

88Gmostly conserved

AACTTTATATTTTATTTTTGGGGCGTGATCGGGAATAGTAGGAACCTCATTAAGTATTTTAATTCGAGCTGAATTAGGACACCCTGGGGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.48%

Haplotypes5

BINs2

Most divergent pair6.7%

N.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Delia florilegasame genus5.3%Delia sanctijacobisame genus5.8%Delia pilifemursame genus6.3%Delia hirticrurasame genus6.6%Delia albulasame genus6.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PCOIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcodemitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_028226 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND116S ribosomal RNA12S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT

The complete instruction manual Delia antiqua carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size713 940 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Delia antiqua0.71 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

08Occurrence & distribution

Record type245 records

Wild obs. + sensor58

Museum / vouchered187

Range

Area of Occupancy AOO280 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy60% within 1 km

≤100 m 18≤1 km 17≤10 km 23

58 georeferenced

Open the mapobservation + sensor58

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy10% within 1 km

≤100 m 1≤1 km 3≤10 km 32>10 km 4

40 georeferenced · 147 without coordinates

Open the institutions mapphysical evidence187

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	11
University of Tokyo, Department of Zoologylocation not on record	10
The University of the West Indies, Trinidad and Tobagolocation not on record	6
Royal Saskatchewan Museumlocation not on record	6
Stockholm, SE	5
Centre for Biodiversity Genomicslocation not on record	5
University of Guelph, Centre for Biodiversity Genomicslocation not on record	4
CBDClocation not on record	4
Biodiversity Institute of Ontariolocation not on record	1
DFFW2018location not on record	1
Gothenburg, SE	1
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	1
NCMGlocation not on record	1
ZMAAlocation not on record	1

14 institutions · 57 of 187 vouchered records shown · 130 without an institution code

09Environmental DNA95 detections

Where the DNA of Delia antiqua was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found95

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 95 detections have coordinates

Open the map2 countries0

Collected on yellow onionFarmlandCollected on : Yellow onionYellow onion fieldCulture : Green onionsForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.9 °C 14.8–21.2

Seasonal swing summer↔winter30.0 °C

Max temp (day)23.5 °C 19.6–25.7

Min temp (night)14.2 °C 11.2–17.0

Precipitation105 mm/mo 92.4–123

Air humidity58.4 % 58.0–59.2

Moisture balance-34.8 mm/mo -53.2–13.2

Vapour deficit908 Pa 714–1,058

Wind speed3.10 m/s 2.70–3.80

Cloud cover44.2 % 42.1–54.9

CHELSA 1981–2010, ~9 km grid, at location & month of 78 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)