Deinandra greeneana

(Rose) B.G.Baldwin · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Deinandra

At a glance

Occurrence records96

Data sources10

Biological traits7

DNA specimens2

eDNA detections1

Sources10 archives

Databases and archives Deinandra greeneana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility96 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources7 traits

Chemical compositionLOTUS7 compounds

Occurrence & distributionGBIF96 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 24

01Narrative

Deinandra greeneana is a rare North American species of plants in the tribe Madieae within the family Asteraceae. Deinandra greeneana has been found only in the state of Baja California in northwestern Mexico. The species was thought for many years to be restricted to Guadalupe Island, 400 km (150 miles) west of the mainland, but it was later discovered on the Pacific Coast of the Baja California Peninsula southwest of Ensenada.Moran, Reid Venable 1968. Transactions of the San Diego Society of Natural History 15: 286–289 diagnosis in Latin, description and commentary in English, photo of type herbarium specimen, as Hemizonia greeneana subsp. peninsularis Deinandra greeneana is an annual herb up to 120 cm (48 inches) tall. It produces many yellow flower heads, each with both disc florets and ray florets.Flora of North America, Deinandra corymbosa (de Candolle) B. G. Baldwin, Novon. 9: 468. 1999.Rose, Joseph Nelson 1890. Contributions from the United States National Herbarium 1: 24 as Hemizonia greeneana Subspecies Deinandra greeneana subsp. greeneana - Guadalupe Island Deinandra greeneana subsp. peninsularis (Moran) B.G.Baldwin - mainland Baja California

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

03Chemical composition7 compounds

Compounds documented for Deinandra greeneana across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Flavonols3

Flavones1

Flavanones1

Dihydroflavonols1

Documented compounds7 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Eriodictyol	present	LOTUS
5,7,3',4'-Tetrahydroxy-3-methoxy-flavonol	present	LOTUS
Kaempferide	present	LOTUS
Luteolin 7-diglucoside	present	LOTUS
Patuletin	present	LOTUS
Quercetin	present	LOTUS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Deinandra greeneana has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences10

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSEF059683.1 ↗640 bp

ACGT

TCGAATCCTGCACAGCAGAACGACCCGTGAACACGTACAACCACATGGCCTCATGAGGACTGATCATTTTGCTTCCGGCCTTGTGAGGAC …

Deinandra greeneana subsp. peninsularis clone 33 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Deinandra greeneana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 241×CCDB · book-atlas-flowering-plants

CCDB · book-atlas-flowering-plants

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

07Deep time~0 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin0 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type96 records

Wild obs. + sensor8

Museum / vouchered88

Range

Area of Occupancy AOO76 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 3≤1 km 2≤10 km 1

6 georeferenced · 2 without coordinates

Open the mapobservation + sensor8

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy97% within 1 km

≤100 m 31≤1 km 2≤10 km 1

34 georeferenced · 54 without coordinates

Open the institutions mapphysical evidence88

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Diego, US	54
Claremont, US	10
University of Stellenboschlocation not on record	6
CASlocation not on record	4
La Paz, MX	3
Santa Barbara, US	3
Riverside, US	2
Los Angeles, US	1

8 institutions · 83 of 88 vouchered records shown · 5 without an institution code

09Environmental DNA1 detections

Where the DNA of Deinandra greeneana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)