Declana floccosa

Walker, 1858 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Geometridae/Declana

At a glance

Occurrence records3 787

Data sources8

Biological traits0

DNA specimens10

eDNA detections17

Sources8 archives

Databases and archives Declana floccosa's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 787 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF3 787 records

Environmental DNA1 datasets · 1 countries17 detections

DNA & barcodingBOLD10 specimens

01Narrative

Declana floccosa, the forest semilooper or manuka moth is a moth of the family Geometridae. It is endemic to New Zealand. It was first described by Francis Walker in 1863 using specimens obtained from Colonel Bolton. The wingspan of this species is 27–35 mm and is extremely variable in colour and patterning. The larvae feed on a wide range of native and exotic broad-leaved and coniferous shrubs and trees. Exotic hosts include Pinus radiata and other Pinus species, Pseudotsuga menziesii, Larix and Eucalyptus. Native hosts include Muehlenbeckia australis.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Declana floccosa has left across the world's sequence archives.

At a glance

DNA specimens10

BINs2

Marker genes1

eDNA detections17

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P627 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 34 variable positions, in barcode order

5Cmostly conserved

40Cmostly conserved

88Gmostly conserved

100Amostly conserved

130Tmostly conserved

160Amostly conserved

169Cmostly conserved

200Gmostly conserved

208Amostly conserved

223Gmostly conserved

247Tmostly conserved

268Amostly conserved

271Tmostly conserved

280Cmostly conserved

325Gmostly conserved

328Amostly conserved

355Cmostly conserved

361Tmostly conserved

367Cmostly conserved

388Gmostly conserved

400Amostly conserved

409Amostly conserved

506Gmostly conserved

508Gmostly conserved

538Amostly conserved

539Tmostly conserved

542Tmostly conserved

547Amostly conserved

568Amostly conserved

577Gvariable

578Cmostly conserved

592Gmostly conserved

607Amostly conserved

616Tvariable

AACACTATATTTTATTTTTGGAATTTGAGCAGGTATAATCGGAACCTCTTTAAGATTACTTATTCGAGCTGAATTAGGAAACCCCGGGTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.4%

Haplotypes4

BINs2

Most divergent pair4.9%

OceaniaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Pero dulariasame family8.8%Pantherodes conglomeratasame family9.6%Astygisa circulariasame family9.6%Astygisa chlororphnodessame family9.9%Opisthoxia curvilineasame family9.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type3 787 records

Wild obs. + sensor3 550

Museum / vouchered237

Range

Area of Occupancy AOO3 676 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 1 993≤1 km 750≤10 km 167>10 km 121

3 031 georeferenced · 519 without coordinates

Open the mapobservation + sensor3 550

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy17% within 1 km

≤100 m 7≤1 km 13≤10 km 99

119 georeferenced · 118 without coordinates

Open the institutions mapphysical evidence237

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Auckland, NZ	160
MWLRlocation not on record	9
Helsinki, FI	7
New Zealand Arthropod Collectionlocation not on record	2

4 institutions · 178 of 237 vouchered records shown · 59 without an institution code

09Environmental DNA17 detections

Where the DNA of Declana floccosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found17

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 17 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.0 °C 11.5–19.0

Seasonal swing summer↔winter9.00 °C

Max temp (day)18.7 °C 14.6–21.4

Min temp (night)14.4 °C 7.40–16.8

Precipitation93.9 mm/mo 76.3–138

Air humidity61.8 % 60.1–64.3

Moisture balance-13.7 mm/mo

Vapour deficit704 Pa 476–861

Wind speed4.10 m/s

Cloud cover36.2 % 32.9–37.7

CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Declana floccosa

At a glance

Sources8 archives

At a glance

Record type3 787 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions2 of 4 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 787 records