Davidsonia johnsonii

J.B.Williams & G.J.Harden · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Oxalidales/Cunoniaceae/Davidsonia

At a glance

Occurrence records254

Data sources8

Biological traits31

DNA specimens3

eDNA detections1

Sources8 archives

Databases and archives Davidsonia johnsonii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility254 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources31 traits

Occurrence & distributionGBIF254 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Davidsonia johnsonii, commonly known as smooth Davidson's plum, is a small tree native to rainforests of eastern Australia. The leaves are compound, glossy and hairless. It is a very rare tree in the wild, but is cultivated for its edible fruit. The fruit is a deep burgundy colour, with a sour flavour and is popular in jams. It is cultivated in small plantations. Due to infertile seeds it can only be propagated from cuttings or division. Hence all cultivated material is derived from clones of wild plants. Plants take at least six years to produce fruit. Some selections are heavy bearing.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology14

Fruit length35 mm

Fruit width45 mm

Leaf length135 mm

Leaf length max300 mm

Leaf length min120 mm

Leaf width37.5 mm

Leaf width max60 mm

Leaf width min15 mm

Petiole length5 cm

Plant height15 m

Plant height max12 m

Plant height min5 m

Seed length17.5 mm

Seed width13.5 mm

Life cycle & reproduction5

Flowering timennnnnnnnnyyn

Life formshrub

Life spanperennial

Raunkiær life formphanerophyte

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typedrupe

Growth formtree

Leaf compoundnesscompound

Leaf shapeoblanceolate obovate

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Davidsonia johnsonii has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes5

GenBank sequences3

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPZ182839.1 ↗351 bpAustralia · 2002

ACGT

TTGACGCAGTTGCGCCCCAAGCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTCACGCATTGTCGCCCCCCAATCACCTCGTCCTGCGAG …

Davidsonia johnsonii voucher BRI AQ740674 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★rbcLa★ITS1trnH-psbA

plant barcodefungal barcodemarker

08Occurrence & distribution

Record type254 records

Wild obs. + sensor151

Museum / vouchered100

Cultivated / captive1

Other2

Origin

Native22

Range

Area of Occupancy AOO316 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 108≤1 km 8≤10 km 8>10 km 4

128 georeferenced · 23 without coordinates

Open the mapobservation + sensor151

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy51% within 1 km

≤100 m 24≤1 km 14≤10 km 31>10 km 5

74 georeferenced · 26 without coordinates

Open the institutions mapphysical evidence100

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	22
Brisbane, AU	20
Armidale, AU	16
Canberra, AU	13
NSW Dept of Planning, Industry and Environmentlocation not on record	9
Museo Entomologico de Leonlocation not on record	5
Hobart, AU	4
Kew, GB	4
Adelaide, AU	2
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	1
Saint Louis, US	1

11 institutions · 97 of 100 vouchered records shown · 3 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Davidsonia johnsonii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.3 °C 19.3–19.3

Seasonal swing summer↔winter9.90 °C

Max temp (day)23.5 °C

Min temp (night)15.6 °C

Precipitation128 mm/mo

Air humidity61.9 %

Moisture balance15.0 mm/mo

Vapour deficit865 Pa

Wind speed1.40 m/s

Cloud cover24.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)