Davidsonia jerseyana

(F.Muell. ex F.M.Bailey) G.J.Harden & J.B.Williams · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Oxalidales/Cunoniaceae/Davidsonia

At a glance

Occurrence records687

Data sources6

Biological traits32

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Davidsonia jerseyana's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility687 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources32 traits

Occurrence & distributionGBIF687 records

DNA & barcodingNCBIsequences

01Narrative

Davidsonia jerseyana, also known as Davidson's plum or Mullumbimby plum, is a small, slender subtropical rainforest tree up to 10 m high. The hairy leaves are compound and 35 - long, with 11–17 leaflets. It is endemic to a restricted area of northern New South Wales on the east coast of Australia. The tree's fruit emerge from the trunk, and superficially resemble the European plum. It is considered an endangered species. There are two other species of Davidson's plum.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology14

Fruit length50 mm

Fruit width40 mm

Leaf length250 mm

Leaf length max600 mm

Leaf length min350 mm

Leaf width55 mm

Leaf width max100 mm

Leaf width min30 mm

Petiole length12.5 cm

Plant height10 m

Plant height max10 m

Seed length20 mm

Seed mass206 mg

Seed width13.5 mm

Life cycle & reproduction6

Deciduousnessevergreen

Flowering timeynnnnnnnnyyy

Life formshrub

Life spanperennial

Raunkiær life formphanerophyte

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typedrupe

Growth formtree

Leaf compoundnesscompound

Leaf shapeoblanceolate oblong

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Davidsonia jerseyana has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPZ182840.1 ↗384 bpAustralia · 2008

ACGT

TGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTCAC …

Davidsonia jerseyana voucher BRI AQ745500 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type687 records

Wild obs. + sensor646

Museum / vouchered39

Cultivated / captive2

Origin

Native18

Range

Area of Occupancy AOO332 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤100 m 1≤10 km 593>10 km 47

641 georeferenced · 5 without coordinates

Open the mapobservation + sensor646

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy3% within 1 km

≤100 m 1≤10 km 36

37 georeferenced · 2 without coordinates

Open the institutions mapphysical evidence39

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy50% within 1 km

≤1 km 1≤10 km 1

2 georeferenced

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	18
Armidale, AU	6
Museo Entomologico de Leonlocation not on record	6
Brisbane, AU	4
Auckland, NZ	2
Canberra, AU	1
Berlin, DE	1
NSW Dept of Planning, Industry and Environmentlocation not on record	1

8 institutions · 39 of 39 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)