Davallia fejeensis

Hook. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Polypodiopsida/Polypodiales/Davalliaceae/Davallia

At a glance

Occurrence records246

Data sources10

Biological traits0

DNA specimens2

eDNA detections2

Sources10 archives

Databases and archives Davallia fejeensis's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility246 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF246 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 80

01Narrative

Davallia fejeensis is a species of fern in the family Davalliaceae, commonly referred to as Rabbit's Foot Fern. They are best known for their furry, brown and yellow rhizomes, which looks like a rabbit's foot, hence the name. It is native to the Fiji Islands in Oceania. They survive from approximately 60-75ºF (15-24ºC) and cannot survive below 55ºF (13ºC). They can grow up to 2 ft at the most.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Davallia fejeensis has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences5

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLDQ646006.1 ↗1 241 bp

ACGT

ACTTATTACACCCCTGAATACAAGACCAAAGATACCGATATCTTAGCAGCATTTCGAATGACCCCACAGCCTGGAGTACCAGCTGAGGAA …

Davallia fejeensis ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL5

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Davallia fejeensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 80 n = 40

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 401×CCDB · Cave1962

CCDB · Cave1962 — Abraham et al. 1962

08Occurrence & distribution

Record type246 records

Wild obs. + sensor185

Museum / vouchered58

Cultivated / captive3

Range

Area of Occupancy AOO512 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 98≤1 km 19≤10 km 8>10 km 15

140 georeferenced · 45 without coordinates

Open the mapobservation + sensor185

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy22% within 1 km

≤1 km 2≤10 km 1>10 km 6

9 georeferenced · 49 without coordinates

Open the institutions mapphysical evidence58

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 2 without coordinates

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Wellington, NZ	5
Bronx, US	5
Auckland, NZ	5
Blumenau, BR	4
Honolulu, US	4
Chongqing Museumlocation not on record	4
Laboratorio de Ictiologialocation not on record	4
Pontifícia Universidade Católica do Paranálocation not on record	3
UNEMATlocation not on record	2
South Kensington, GB	2
University of Stellenboschlocation not on record	2
Feira de Santana, BR	1
Museo Nacional de Costa Rica (MNCR)location not on record	1
Philadelphia, US	1
Kew, GB	1
Ann Arbor, US	1
Minia, EG	1
HAWlocation not on record	1
Karlsruhe, DE	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
JBRJlocation not on record	1
Riverside, US	1
Henry Brockhouse Collectionlocation not on record	1
Bangkok, TH	1
Uppsala, SE	1
UNISANTAlocation not on record	1
Universidade Federal do Rio Grande do Nortelocation not on record	1
Museo naturalistico del Frignano Ferruccio Minghellilocation not on record	1

28 institutions · 57 of 58 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Davallia fejeensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.7 °C 22.7–22.7

Seasonal swing summer↔winter4.00 °C

Max temp (day)26.9 °C

Min temp (night)19.5 °C

Precipitation184 mm/mo

Air humidity64.7 %

Moisture balance39.2 mm/mo

Vapour deficit973 Pa

Wind speed3.10 m/s

Cloud cover45.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)