Daucus insularis

(Parl. ex Webb) Spalik, Wojew., Banasiak & Reduron · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Apiales/Apiaceae/Daucus

At a glance

Occurrence records33

Data sources8

Biological traits3

DNA specimens0

eDNA detections1

Sources8 archives

Databases and archives Daucus insularis's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility33 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources3 traits

Occurrence & distributionGBIF33 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 22

01Narrative

Daucus insularis is a species of flowering plants of the family Apiaceae. The species is endemic to Cape Verde.Oromí, Martín, Zurita & Cabrera, 2005 : Lista preliminar de especies silvestres de Cabo Verde: Hongos, Plantas y Animales Terrestres. Gobierno de Canarias, Consejería de Medio Ambiente y Ordenación Territorial, p. 41 The species was first described by Filippo Parlatore in 1849 as Tetrapleura insularis.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRY

Life cycle & reproduction1

Life formannual or perennial

Habitat & environment2

Climatesubtropical

Growth formherb

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Daucus insularis has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSON064040.1 ↗604 bp

ACGT

TCGAATCCTGTGATACCAGAATGACTTGTTAACATGTAACAACAACGGGCAAGCAACTGTGGGCCTTTGGTCCCCTGTTTGTGAACCCAA …

Daucus insularis voucher Univ. of Reading 3348, from 4688 1972 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Daucus insularis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome records16–222n range18median22mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 182×CCDB · book-ipcn72

CCDB · book-ipcn72 — BRAMWELL, D., C.J. HUMPHRIES, B.G. MURRAY, & S.J. OWENS. 1972. Chromosome studies in the flora of Macaronesia. Bot. Notiser 125: 139-152.

CCDB · book-ipcn72 — BRAMWELL, D . & B.G. MURRAY. 1972. A preliminary report on the cytology of some Cape Verde Islands plants. Cuad. Bot. Canar. XIV/XV: 27-29.

2n 222×CCDB · book-ipcn72

CCDB · book-ipcn72 — BRAMWELL, D., C.J. HUMPHRIES, B.G. MURRAY, & S.J. OWENS. 1972. Chromosome studies in the flora of Macaronesia. Bot. Notiser 125: 139-152.

CCDB · book-ipcn72 — BRAMWELL, D . & B.G. MURRAY. 1972. A preliminary report on the cytology of some Cape Verde Islands plants. Cuad. Bot. Canar. XIV/XV: 27-29.

2n 161×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Borgen, L. 1980. Chromosome numbers of Macaronesian flowering plants III. Bot. Macaronés. IV, Cien. 7: 67–76.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=0.960 ↗

08Occurrence & distribution

Record type33 records

Wild obs. + sensor12

Museum / vouchered21

Range

Area of Occupancy AOO40 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 8≤1 km 3

11 georeferenced · 1 without coordinates

Open the mapobservation + sensor12

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 21 records without

Open the institutions mapphysical evidence21

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	21

1 institutions · 21 of 21 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Daucus insularis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)