Daucus carota
speciesAt a glance
Occurrence records598 128
Data sources17
Biological traits73
DNA specimens107
eDNA detections73
Sources17 archives
Databases and archives Daucus carota's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility598 115 records↗
OBISOcean Biodiversity Information System13 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI73 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics107 specimens↗
FooDBThe Metabolomics Innovation Centrecompounds↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
NCBIUS National Library of Medicinegenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources73 traits
Chemical compositionFooDB · LOTUS · NPASS6 343 compounds
Occurrence & distributionGBIF · OBIS598 128 records
Environmental DNA5 datasets · 16 countries73 detections
DNA & barcodingBOLD107 specimens
Genome at a glanceCCDB · GoaT · NCBI548 Mbp
01Narrative
Daucus carota, en français Carotte sauvage, Carotte commune, Daucus carotte ou simplement Carotte, est une espèce de plantes à fleurs dicotylédones de la famille des Apiaceae, originaire des régions tempérées de l'Ancien monde. Les carottes cultivées appartiennent à la sous-espèce Daucus carota subsp. sativus.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology23
Fruit length3.5 mm
⚠ sources differ — AusTraits: 3.5 mm · GIFT: 2.83 mm
Fruit length max4 mm
Fruit length min1.5 mm
Fruit width1.67 mm
Fruit width max2 mm
Fruit width min2 mm
Leaf length148 mm
Leaf length max150 mm
Leaf mass12.84 mg
Leaf size2 220 mm²
Plant height0.573 m
⚠ sources differ — GIFT: 0.573 m · AusTraits: 1.25 m · LEDA: 0.412 m · TRY: 0.305 m
Plant height generative0.696 m
Plant height max1.79 m
Plant height min0.15 m
Seed length2.95 mm
⚠ sources differ — TRY: 2.95 mm · GIFT: 2.7 mm
Seed length max2.7 mm
Seed length min2.7 mm
Seed mass1.06 mg
⚠ sources differ — TRY: 1.06 mg · LEDA: 1.09 mg · GIFT: 1.0 mg
Seed mass max3.2 mg
Seed mass min0.5 mg
Seed volume0.87 mm³
Seed volume max0.87 mm³
Seed volume min0.87 mm³
Life cycle & reproduction16
Deciduousnessdeciduous
Dispersal typeanimal
Flower colourpurple
Flowering endJul
Flowering startJun
Flowering timeyyyyynnnyyyy
Life formbiennial
Life spanstrict monocarpic bi-annuals and poly-annuals
⚠ sources differ — TRY: strict monocarpic bi-annuals and poly-annuals · AusTraits: biennial · LEDA: strict monocarpic bi-annuals and poly-annuals · GIFT: biennial
Lifespan years2 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Seed number4 000
Self fertilizationpresent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment16
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max3 000 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typemericarp
Growth formherb
Habitat GIFTÁrea Antrópica
Leaf compoundnesscompound
Leaf formelliptic
Mycorrhizaabsent
Mycorrhiza typeAMNM
Succulenceno
Woodinessnon-woody
Physiology & chemistry10
Leaf C:N ratio10.69 g/g
Leaf c413 mg/g
Leaf dry-matter content (LDMC)253 mg/g
⚠ sources differ — TRY: 253 mg/g · LEDA: 232 mg/g
Leaf n37.36 mg/g
Leaf p2.41 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)17.33 mm²/mg
⚠ sources differ — TRY: 17.33 mm²/mg · LEDA: 18.73 mm²/mg · GIFT: 19.76 mm²/mg
Wood density79.8 mg/cm³
Other traits6
Defenseyes
Diaspore typeone-seeded generative dispersule
Inflorescenceumbel
Monocarpymonocarp
Seeds per fruit>1000
Shoot orientationerect
03Chemical composition6 343 compounds
Compounds documented for Daucus carota across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cookingVegetables
Compound class profile5 classes
Aminoacids107
Cinnamic acids and derivatives82
Glycerophospholipids57
Acyclic monoterpenoids49
Pinane monoterpenoids48
Documented compounds6 343 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| Petroselinic acid | 71,200 mg/100g | FooDB | |
| Sucrose | 19,950 mg/100g | FooDB | |
| Pectic acid | 14,400 mg/100g | FooDB | |
| Elaidic acid | 14,305 mg/100g | FooDB | |
| beta-D-Glucopyranose | 8,000 mg/100g | FooDB | |
| Phytic acid | 5,270 mg/100g | FooDB | |
| (Z,Z)-9,12-Octadecadienoic acid | 2,638 mg/100g | FooDB | |
| Potassium | 2,468 mg/100g | FooDB | |
| α-D-galactose | 2,000 mg/100g | FooDB | |
| Nitrogen | 1,070 mg/100g | FooDB |
05DNA & barcoding107 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Daucus carota has left across the world's sequence archives.
At a glance
DNA specimens107
Marker genes13
eDNA detections73
Countries16
The DNA barcodethe species' typical barcode, built from every sequenced specimen
COI-5P1 497 bp consensus8 specimens
ACGT
▸ drag or hover over the strip to read any position — letter and how much it varies
Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.
Where individuals differ — all 6 variable positions, in barcode order
66Cmostly conserved
873Cmostly conserved
1420Cmostly conserved
1486Tmostly conserved
1494Gmostly conserved
1495Tmostly conserved
ATGGGCACATGCTTCTCAGTACTGATTCGTATGGAATTAGCACGACCCGGCGATCAAATTCTTGGCGGGAATCATCAACTTTATAATGTT …
Variant network
Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.
Diversity (π)0.12%
Haplotypes4
BINs0
Most divergent pair0.40%
EuropeAfrica
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK★rbcL★rbcLa★trnL-F★ITS★ITS1★ITS2atp6COIICOXIIIrpoC1trnH-psbA
animal barcodeplant barcodefungal barcodemitochondrialmarker
Organelle genome
Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.
▸ Tap any coloured segment — or a gene chip — to see what it is
Mitochondrion
NC_087060 ↗ · 35 protein · 18 tRNA · 3 rRNA
atp8ccmFNrps13nad1ccmFcnad4rpl5rps1nad3rps12nad2nad5nad9atp6matRrpl2ccmBcox3rpl16rps3nad7mttBrpl10cox2ccmCnad4L+12
Pick a coloured segment on the ring — or a gene chip — to read what that gene does.
protein-codingrRNAtRNA
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Daucus carota carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size547 680 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Daucus carota0.55 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 18 n = 9
Ploidy2× diploid · measured
Chromosome records12–222n range18median18mode161records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 18156×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl +17
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — BARTOLO G., BRULLO S., PAVONE P. - 1979. Numeri cromosomici per la flora italiana:617-631.. Inform. Bot. Ital. , 11(2): 149-158.
CCDB · ita-fl — GADELLA T.W.J., KLIPHUIS E. - 1970. Cytotaxonomic investigations in some Angiosperms collected in the valley of Aosta and in the National Park Gran Paradiso.. Caryologia , 23(3): 363-379.
CCDB · ita-fl — LARSEN K. - 1954. Chromosome numbers of some European flowering plants.. Bot. Tidsskr. , 50(2): 163-174.
CCDB · slov-fl — Májovský J. et al., 1970a: Index of chromosome numbers of Slovakian flora (Part 1). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 16: 1-26.
CCDB · iapt — IAPT/IOPB Chromosome Data 9
CCDB · iapt — IAPT/IOPB Chromosome Data 8
CCDB · brit-fl — Maude, P.F. New Phytol. 38: 1-31 (1939)
CCDB · brit-fl — Dempsey, R.E., Gornall, R.J., Bailey, J.P. Watsonia 20: 63-66 (1994)
CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. Queirs, M.Anurio Soc. Brot.38: 293(1972).
CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. VII. Umbelliferae, supl. 1. Queirs, M.Bol. Soc. Brot. ser. 248: 171-186(1974).
CCDB · iber-fl — Estudio citotaxonmico de la flora de las costas gallegas Lago Canzobre, E. & S. Castroviejo.Cadernos rea Ci. Biol.3: 1-215(1993).
CCDB · iber-fl — Donnees caryologiques sur la tribu des caucalidees (Umbelliferae). Perpignan. Cauwet, A. M. & S. Jury.*(1977).
CCDB · iber-fl — Contribution l'tude cytotaxonomique de la flore das Balares. I Cardona, M. A.Acta Phytotax. Barcinon.14: 1-20(1973).
CCDB · iber-fl — Contribuiao para o estudo cariolgico da familia Umbelliferae. I Gard, A. & N. Malheiros-Gard.Agron. Lusit.11(2): 91-140(1949).
CCDB · iber-fl — Chromosome atlas of flowering plants. Darlintong, C. D. & A. P. Wylie.*(1955).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3320
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3321
CCDB · fl-europaea — Gadella & Kliphuis,
CCDB · poland — Skali?ska M., Pogan E., Czapik R. et al. 1978. Further studies in chromosome numbers of Polish Angiosperms. Twelfth contribution. Acta Biol. Cracov. Ser. Bot. 21, 31-63.
CCDB · mediterranean
CCDB · ipcn-api-dl — Bartolo, G., S. Brullo & P. PAVONE. 1979. Numeri cromosomici per la flora Italiana: 617-631. Inform. Bot. Ital. 11: 149–159.
CCDB · ipcn-api-dl — Silvestre, S. 1978. Contribucion al estudio cariologicos de la familia Umbelliferae en la peninsula Iberica. 11. Lagascalia 7: 163–172.
CCDB · ipcn-api-dl — Dmitrieva, S. A. & V. I. Parfenov. 1985. Kariologicheskaja kharakteristika nekotorykh vidov poleznykh rastenij flory Belorussii. Izv. Akad. Nauk Belorussk. SSR, Ser. Biol. Nauk 6: 3–8.
CCDB · ipcn-api-dl — Hamal, I. A., A. LANGER & A. K. Koul. 1986. Nucleolar organizing region in the Apiaceae (Umbelliferae). Pl. Syst. Evol. 154: 11–30.
CCDB · ipcn-api-dl — Das, A. B. & R. Mallick. 1985. Karyotype study in Apium graveolens L., Daucus carota L. and Hydrocotyle asiatica L. Proc. Indian Sci. Congr. Assoc. 73(3–VI): 126.
CCDB · ipcn-api-dl — Rostovtseva, T. S. 1982. The chromosome numbers of some species of the family Apiaceae. III. Bot. Zhurn. SSSR 67 (2): 206–210. (In Russian).
CCDB · ipcn-api-dl — Subramanian, D. 1986. Cytotaxonomical studies in south Indian Apiaceae. Cytologia 51: 479–488.
CCDB · ipcn-api-dl — Krishnappa, D. G. & A. N. Basappa. 1988. SOCGI plant chromosome number reports -- VI. J. Cytol. Genet. 23: 38–52.
CCDB · ipcn-api-dl — Skalinska, M. 1978. Further studies in chromosome numbers of Polish angiosperms. Twelfth contribution. Acta Biol. Cracov., Ser. Bot. 21: 31–63.
CCDB · ipcn-api-dl — Dobea, C., B. Hahn & W. Morawetz. 1997. Chromosomenzahlen zur Gefässpflanzen-Flora Österreichs. Linzer Biol. Beitr. 29(1): 5–43.
CCDB · ipcn-api-dl — Albers, F. & W. Pröbsting. 1998. In R. Wisskirchen & H. Haeupler, Standardliste der Farn- und Blütenpflanzen Deutschlands. Bundesamt für Naturschutz & Verlag Eugen Ulmer, Stuttgart.
CCDB · ipcn-api-dl — Bayliss, M. W. 1975. The effects of growth in vitro on the chromosome complement of Daucus carota (L.) suspension cultures. Chromosoma 51: 401–411.
CCDB · ipcn-api-dl — Ahmad, I. & A. K. Koul. 1980. In Chromosome number reports LXVIII. Taxon 29: 543.
CCDB · ipcn-api-dl — Schrader, O., R. Ahue & J. Fuchs. 2003. Karyotype analysis of Daucus carota L. using Giemsa C-banding and FISH of 5S and 18S/25S rRNA. Caryologia 56: 149–154.
CCDB · ipcn-api-dl — Sharma, A. K. 1970. Annual report, 1967-1968. Res. Bull. Univ. Calcutta Cytogenetics Lab. 2: 1–50.
CCDB · ipcn-api-dl — Queirós, M. 1985. Números cromosómicos para a flora Portuguesa. 86-103. Bol. Soc. Brot. 58: 85–96.
CCDB · ipcn-api-dl — Queiros, M. 1974a. Contribucao para o conhecimento citotaxonomico das Spermatophyta de Portugal. VII. Umbelliferae, Supl. 1. Bol. Soc. Brot., sér. 2 48: 171–186.
CCDB · ipcn-api-dl — Queiros, M. 1978. Numeros cromosomicos para a flora Portuguesa 1-15. Bol. Soc. Brot., sér. 2 52: 69–77.
+92 more references
2n 223×CCDB · book-indian_vol1 · CCDB · book-fedorov · CCDB · book-atlas-flowering-plants
CCDB · book-indian_vol1 — Melderis, A. 1930
CCDB · book-fedorov — Melderis 1930
CCDB · book-atlas-flowering-plants — Wanscher 1932
2n 121×CCDB · iber-fl
CCDB · iber-fl — Datos cariolgicos de algunas plantas espaolas. Gallego Martn, F., J. Elena Rosell & M. A. Snchez Anta.Stud. Bot. Univ. Salamanca3: 317-320(1984).
2n 201×CCDB · kew
CCDB · kew — Owens S. 1974. An examination of the floral biology, breeding system and cytology in species of the genus Daucus and related genera in the tribe Caucealidea (Umbelliferae). Ph. D. Thesis, University of Reading.
n 921×CCDB · iber-fl · CCDB · mediterranean · CCDB · book-ipcn65 +3
CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 556-591. Pastor Daz, J. & al.Lagascalia15(2): 269-282(1990).
CCDB · iber-fl — Donnees caryologiques sur la tribu des caucalidees (Umbelliferae). Perpignan. Cauwet, A. M. & S. Jury.*(1977).
CCDB · iber-fl — Contribuiao para o estudo cariolgico da familia Umbelliferae. II Malheiros-Gard, N. & A. Gard.Gent. Ibr.3: 23-35(1951).
CCDB · mediterranean
CCDB · book-ipcn65 — Bostick 1965
CCDB · ipcn-api-dl — Silvestre, S. 1978. Contribucion al estudio cariologicos de la familia Umbelliferae en la peninsula Iberica. 11. Lagascalia 7: 163–172.
CCDB · ipcn-api-dl — Mulligan, G. A. 1984. Chromosome numbers of some plants native and naturalized in Canada. Naturaliste Canad. 111: 447–449.
CCDB · ipcn-api-dl — Pastor, J., J. C. Diosdado, C. S. Bárbara, J. Vique & E. Pérez. 1990. Números cromosómicos para la flora Española. 556--591. Lagascalia 15: 269–282.
CCDB · ipcn-api-dl — Krishnappa, D. G. & A. N. Basappa. 1988. SOCGI plant chromosome number reports -- VI. J. Cytol. Genet. 23: 38–52.
CCDB · ipcn-api-dl — Wetschnig, W. & G. H. Leute. 1991. Chromosomenzahlen Kärntner Gefässflanzen (Teil 2, Doldenblütler---Apiaceae = Umbelliferae). Linzer Biol. Beitr. 23: 457–481.
CCDB · ipcn-api-dl — Contandriopoulos, J., D. Noguet & C. Zevaco-Schmitz. 1987. Contribution à l'étude de quelques espèces interessantes de Corse: cytotaxonomie et comportement écologique. Biol.-Ecol. Medit. 10: 259–271.
CCDB · ipcn-api-dl — Khatoon, S. & S. I. Ali. 1993. Chromosome Atlas of the Angiosperms of Pakistan. Department of Botany, University of Karachi, Karachi.
CCDB · book-ipcn75-78 — Constance et al. 1976
CCDB · CromoCat 2015 — Pastor Díaz, J., J. C. Diosdado, C. Santa Bárbara, J. Vioque & E. Pérez. (1990). Números cromosómicos para la flora española, 556-591. Lagascalia 15(2): 269-282.
CCDB · CromoCat 2015 — Rogers, J. L. (1965). Documented plant chromosome numbers 65: Sida 2: 163-170.
CCDB · CromoCat 2015 — Wetschnig, W. & G. H. Leute. (1991). Chromosomenzahlen Kärntner Gefässflanzen (Teil 2, Doldenblütler---Apiaceae = Umbelliferae). Linzer Biol. Beitr. 23: 457-481.
CCDB · CromoCat 2015 — Queirós, M. (1978b). Sur la caryologie des Ombellifères du Portugal Actes du 2nd Symposium International sur les Ombellifères - Perpignan 325-334
CCDB · CromoCat 2015 — Khatoon, S. & Ali, S. I. (1993). Chromosome Atlas of the Angiosperms of Pakistan. Department of Botany, University of Karachi, Karachi
CCDB · CromoCat 2015 — Silvestre, S. (1978). Contribución al estudio cariológico de la familia Umbelliferae en la Península Ibérica. II. Lagascalia 7(2): 163-172.
CCDB · CromoCat 2015 — Cauwet, A. M. & Jury, S. (1977). Donnees caryologiques sur la tribu des caucalidees (Umbelliferae). Perpignan.
CCDB · CromoCat 2015 — Malheiros, N. & Gardé, A. (1951a). Contribuiçao para o estudo cariológico da familia Umbelliferae. II. Genét. Ibér. 3: 23-35.
n 61×CCDB · iber-fl
CCDB · iber-fl — Datos cariolgicos de algunas plantas espaolas. Gallego Martn, F., J. Elena Rosell & M. A. Snchez Anta.Stud. Bot. Univ. Salamanca3: 317-320(1984).
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelComplete Genome
08Occurrence & distribution
Record type598 128 records
Wild obs. + sensor580 829
Museum / vouchered13 062
Cultivated / captive809
Fossil1
Other3 427
Origin
Native15 572
Introduced1 734
Range
Area of Occupancy AOO616 200 km²
Depth
0–200 m sunlit0
200–1000 m twilight0
1–4 km midnight1
>4 km abyssal0
median 2 100 m · max 2 100 m · 1 record with depth
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy37% within 1 km
≤100 m 100 742≤1 km 69 000≤10 km 278 824>10 km 4 736
453 302 georeferenced · 127 527 without coordinates
Open the mapobservation + sensor580 829
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy37% within 1 km
≤100 m 837≤1 km 1 624≤10 km 4 013>10 km 257
6 731 georeferenced · 6 331 without coordinates
Open the institutions mapphysical evidence13 062
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy7% within 1 km
≤100 m 2≤1 km 19≤10 km 235>10 km 29
285 georeferenced · 524 without coordinates
Open the mapnot free-living809
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions281 of 503 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 1 537 |
| Philadelphia, US | 424 |
| Moscow State Universitylocation not on record | 404 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 389 |
| Chongqing Museumlocation not on record | 293 |
| Berlin, DE | 291 |
| LDlocation not on record | 266 |
| Yangling, CN | 230 |
| Uniwersytet Warszawskilocation not on record | 198 |
| Madison, US | 192 |
| POL003location not on record | 186 |
| Beijing, CN | 177 |
| Chengdu, CN | 175 |
| Salzburg, AT | 162 |
| Nanjing, CN | 148 |
| Wuzhou, CN | 122 |
| Bloomington, US | 118 |
| Bronx, US | 115 |
| Kew, GB | 107 |
| BFLlocation not on record | 104 |
| Olocation not on record | 104 |
| Spearfish, US | 101 |
| Québec, CA | 95 |
| Oskarshamn, SE | 94 |
| College Park, US | 78 |
| Adam Mickiewicz University in Poznańlocation not on record | 78 |
| Görlitz, DE | 76 |
| HUN003location not on record | 71 |
| Auckland, NZ | 71 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 69 |
| Alicante, ES | 65 |
| GZUlocation not on record | 62 |
| Museo Entomologico de Leonlocation not on record | 61 |
| Barcelona, ES | 61 |
| Bangkok, TH | 59 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 58 |
| WTUlocation not on record | 58 |
| Tartu, EE | 57 |
| CICYTEXlocation not on record | 57 |
| McWane Science Centerlocation not on record | 57 |
| Zürich, CH | 56 |
| QAUlocation not on record | 56 |
| Burlington, US | 52 |
| Williamsburg, US | 51 |
| South Kensington, GB | 51 |
| València, ES | 49 |
| Uniwersytet Śląski w Katowicachlocation not on record | 48 |
| Guangzhou, CN | 47 |
| Ann Arbor, US | 47 |
| New Haven, US | 47 |
| GBR006location not on record | 46 |
| University of New Hampshirelocation not on record | 46 |
| Allentown, US | 46 |
| Riverside, US | 45 |
| UIBlocation not on record | 45 |
| MeiseBGlocation not on record | 44 |
| University of Stellenboschlocation not on record | 44 |
| Corvallis, US | 43 |
| Provincia di Livornolocation not on record | 43 |
| BDBClocation not on record | 43 |
| Uppsala, SE | 42 |
| Pullman, US | 41 |
| Saint Louis, US | 40 |
| SLU Artdatabankenlocation not on record | 40 |
| Canberra, AU | 40 |
| Green Bay, US | 39 |
| BClocation not on record | 36 |
| Bern, CH | 36 |
| Adelaide, AU | 36 |
| Fort Worth, US | 35 |
| Kunming, CN | 35 |
| Appalachian State Universitylocation not on record | 35 |
| Mount Annan, AU | 35 |
| Millersville, US | 34 |
| Montréal, CA | 34 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 34 |
| Chengdu, CN | 34 |
| Zürich, CH | 33 |
| BRNUlocation not on record | 33 |
| Christchurch, NZ | 33 |
| Western Carolina Universitylocation not on record | 32 |
| Entomological Society of Latvialocation not on record | 32 |
| Uniwersytet Opolskilocation not on record | 32 |
| UGentlocation not on record | 32 |
| Pretoria, ZA | 32 |
| Wellington, NZ | 31 |
| Canadian Department of Agriculturelocation not on record | 30 |
| Davis, US | 29 |
| MAlocation not on record | 28 |
| Wlocation not on record | 27 |
| Natural History Museum Rotterdamlocation not on record | 26 |
| Frankfurt am Main | 26 |
| Durango, MX | 26 |
| Toronto, CA | 25 |
| Pamplona, ES | 25 |
| Mlocation not on record | 24 |
| KMNlocation not on record | 23 |
| Claremont, US | 23 |
| Vitoria, ES | 23 |
| Austin, US | 23 |
| UChlocation not on record | 23 |
| Hobart, AU | 23 |
| St. Paul, US | 23 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 22 |
| Acadia Universitylocation not on record | 22 |
| Turku, FI | 21 |
| Rishon Le Zion, IL | 21 |
| Paris, FR | 21 |
| Whitewater, US | 21 |
| Norfolk, US | 20 |
| Chapel Hill, US | 20 |
| Tallinn, EE | 20 |
| Pittsburg, US | 20 |
| ROM007location not on record | 19 |
| Fayetteville, US | 19 |
| Denver, US | 19 |
| Lanzhou, CN | 19 |
| Santa Barbara, US | 19 |
| Chadron, US | 19 |
| Oulu, FI | 18 |
| Rotorua, NZ | 18 |
| Nagano City, JP | 18 |
| Jyväskylä, FI | 18 |
| Flagstaff, US | 18 |
| Palacký University in Olomouclocation not on record | 17 |
| ESP026location not on record | 17 |
| Moscow, US | 17 |
| Jackson, US | 16 |
| Seoul, KR | 16 |
| Guilin, CN | 16 |
| GMBAlocation not on record | 16 |
| Arcata, US | 16 |
| Tsukuba, JP | 15 |
| TUR-Alocation not on record | 15 |
| Lord Fairfax Community Collegelocation not on record | 15 |
| Dekalb, US | 15 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 15 |
| Portland, US | 15 |
| IDElocation not on record | 15 |
| Université Lavallocation not on record | 15 |
| Chicago, US | 14 |
| Xining, CN | 14 |
| DBF-NHMDlocation not on record | 14 |
| Sanda, JP | 14 |
| Saint John, CA | 14 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 13 |
| Brisbane, AU | 13 |
| China Agricultural Universitylocation not on record | 13 |
| Madrid, ES | 13 |
| Dover, US | 13 |
| Tula State Universitylocation not on record | 12 |
| Salamanca, ES | 12 |
| Armidale, AU | 12 |
| Hangzhou, CN | 12 |
| GJOlocation not on record | 12 |
| Hudson, US | 12 |
| Knoxville, US | 12 |
| Clemson, US | 11 |
| Keene State Universitylocation not on record | 11 |
| SXTCMlocation not on record | 11 |
| Porrentruy, CH | 11 |
| Bergen, NO | 11 |
| Morgantown, US | 11 |
| Minia, EG | 11 |
| Trondheim, NO | 11 |
| Columbia, US | 11 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 11 |
| Jena Microbial Resource Collectionlocation not on record | 10 |
| Phoenix, US | 10 |
| Mississippi State, US | 10 |
| University of Tennessee at Chattanoogalocation not on record | 10 |
| Xian, CN | 10 |
| Universidad de La Salle (La Salle)location not on record | 10 |
| Kensington, AU | 10 |
| Victoria, CA | 10 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 10 |
| San Diego, US | 10 |
| AUAlocation not on record | 10 |
| Macomb, US | 10 |
| Tuscaloosa, US | 10 |
| EL PASO, US | 10 |
| Otaru, JP | 10 |
| National Institute of Biological Resourceslocation not on record | 10 |
| Johnson City, US | 9 |
| Helsinki, FI | 9 |
| Staten Island, US | 9 |
| Puerto Ayora, EC | 9 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 9 |
| Taipei, TW | 9 |
| Museum of the Rockieslocation not on record | 9 |
| Albuquerque, US | 9 |
| Karlsruhe, DE | 9 |
| Baroda, IN | 9 |
| GAlocation not on record | 9 |
| Logan, US | 8 |
| Nanchong, CN | 8 |
| Provo, US | 8 |
| Ypsilanti, US | 8 |
| New Brunswick, US | 8 |
| Harrisonburg, US | 8 |
| Angwin, US | 8 |
| CJBGlocation not on record | 7 |
| San Luis Obispo, US | 7 |
| University of Guelph, OAC Herbariumlocation not on record | 7 |
| Los Angeles, US | 7 |
| Sevilla, ES | 7 |
| Valdosta State Universitylocation not on record | 7 |
| Durban, ZA | 7 |
| Tacoma, US | 7 |
| Mount Pleasant, US | 7 |
| Tampa, US | 7 |
| Wuhan, CN | 7 |
| University of Southern Mississippilocation not on record | 7 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 7 |
| ESP027location not on record | 7 |
| Bourges, FR | 7 |
| Tilburg, NL | 6 |
| Little Rock, US | 6 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 6 |
| Davenport, US | 6 |
| TROMlocation not on record | 6 |
| Odawara, JP | 6 |
| Chicago, US | 6 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 6 |
| US | 6 |
| Guiyang, CN | 6 |
| Fairfax, US | 6 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 6 |
| Kingston, US | 6 |
| Universidad Católica de Oriente (UCO)location not on record | 6 |
| Chiba, JP | 6 |
| Trois-Rivières, CA | 6 |
| Frauenfeld, CH | 6 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 6 |
| Shanghai, CN | 6 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 6 |
| Lincoln, US | 5 |
| CASlocation not on record | 5 |
| Leiden University Medical Centerlocation not on record | 5 |
| Wuhan, CN | 5 |
| Bend, US | 5 |
| AZE015location not on record | 5 |
| 云南省思茅市民族传统医药研究所location not on record | 5 |
| Bando, JP | 5 |
| Universidad de Caldas (UCaldas)location not on record | 5 |
| Granada, ES | 5 |
| Richmond, US | 5 |
| Podgorica, ME | 5 |
| Zhejiang Universitylocation not on record | 5 |
| Awka, NG | 5 |
| College of the Atlantic, Museumlocation not on record | 5 |
| BSBIlocation not on record | 5 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 5 |
| Ashland, US | 5 |
| Fulda, DE | 5 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 5 |
| DULlocation not on record | 5 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 5 |
| Washington, US | 5 |
| SZUlocation not on record | 5 |
| Philadelphia, US | 4 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 4 |
| Glarus, CH | 4 |
| ROM023location not on record | 4 |
| Stockholm, SE | 4 |
| KIRMlocation not on record | 4 |
| National Biodiversity Institute, Costa Ricalocation not on record | 4 |
| Cheney, US | 4 |
| Batemans Bay, AU | 4 |
| Missoula, US | 4 |
| Göteborg, SE | 4 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 4 |
| University of Copenhagen, Natural History Museum of Denmark, Herbarium Clocation not on record | 4 |
| Naturalis Biodiversity Centerlocation not on record | 4 |
| JBSlocation not on record | 4 |
| Bozeman, US | 4 |
| FUVATESlocation not on record | 4 |
| Zhengzhou, CN | 4 |
| Boise, US | 4 |
| 黔东南州民族医药研究所标本室location not on record | 4 |
| San Francisco, US | 4 |
| Peking Universitylocation not on record | 4 |
| Denton, US | 4 |
| National Museum Waleslocation not on record | 4 |
| Porvoo, FI | 4 |
| Northridge, US | 4 |
| ASUlocation not on record | 4 |
| University of Wisconsinlocation not on record | 4 |
| Royal Botanical Gardenslocation not on record | 4 |
| Waverly, US | 3 |
| Guiyang, CN | 3 |
| LfUlocation not on record | 3 |
| Taipei, TW | 3 |
| KURAlocation not on record | 3 |
| Kushiro City Museumlocation not on record | 3 |
| Istituto Agrario Castelnuovolocation not on record | 3 |
| FUNEDlocation not on record | 3 |
| Orem, US | 3 |
| Tokushima, JP | 3 |
| Giardini Botanici Hanburylocation not on record | 3 |
| Tuxtla Gutiérrez, MX | 3 |
| NMBU:MINAlocation not on record | 3 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 3 |
| Oswego, US | 3 |
| Universite de Montpellierlocation not on record | 3 |
| Universidade Federal de Juiz de Foralocation not on record | 3 |
| DOI/NPS, Greenbelt Parklocation not on record | 3 |
| GB | 3 |
| Universidad de Antioquia (UdeA)location not on record | 3 |
| DASSHlocation not on record | 3 |
| WINlocation not on record | 3 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 3 |
| ESP003location not on record | 3 |
| US | 3 |
| Mohonk Preservelocation not on record | 3 |
| Chengdu, CN | 3 |
| Mexico City, MX | 3 |
| Irvine, US | 3 |
| Smithsonian Institutionlocation not on record | 3 |
| Academy of Sciences of the Republic of Uzbekistanlocation not on record | 3 |
| Mexico City, MX | 3 |
| John T. Waterhouse Herbariumlocation not on record | 3 |
| ESP109location not on record | 3 |
| Universidad Nacional de Colombia (UNAL)location not on record | 3 |
| Philadelphia, US | 3 |
| Lubbock, US | 3 |
| AZE014location not on record | 2 |
| Nijmegen, NL | 2 |
| Changsha, CN | 2 |
| Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record | 2 |
| Whitehorse, CA | 2 |
| Strecker Museum, Baylor Universitylocation not on record | 2 |
| Maringá, BR | 2 |
| Santa Cruz de la Sierra, BO | 2 |
| Phyletisches Museum Jenalocation not on record | 2 |
| Museo Achille Folettolocation not on record | 2 |
| Ivano-Frankivsk, UA | 2 |
| Mérida, MX | 2 |
| Córdoba, AR | 2 |
| Parthenon Tama History Museumlocation not on record | 2 |
| Guatemala, GT | 2 |
| Bothell, US | 2 |
| Universidad del Quindío (UniQuindío)location not on record | 2 |
| PUC-RSlocation not on record | 2 |
| OLAlocation not on record | 2 |
| Russellville, US | 2 |
| Palmerston North, NZ | 2 |
| Blumenau, BR | 2 |
| UFPRlocation not on record | 2 |
| Kochi, JP | 2 |
| Sion, CH | 2 |
| Iwate Prefectural Museumlocation not on record | 2 |
| Xian, CN | 2 |
| West Virginia Wesleyan Collegelocation not on record | 2 |
| Umeå Universitylocation not on record | 2 |
| San Angelo, US | 2 |
| Pamplona, ES | 2 |
| Bratislava, SK | 2 |
| BGR001location not on record | 2 |
| Riobamba, EC | 2 |
| DOI/NPS, San Juan Island National Historical Parklocation not on record | 2 |
| Long Beach, US | 2 |
| Ivano-Frankove, UA | 2 |
| Ciudad de México, MX | 2 |
| Weber State Universitylocation not on record | 2 |
| Honolulu, US | 2 |
| Meguro Parasitological Museumlocation not on record | 2 |
| FLADlocation not on record | 2 |
| San Jose, US | 2 |
| Campo Grande, BR | 2 |
| Fredericksburg, US | 2 |
| Taiyuan Normal Universitylocation not on record | 2 |
| Portland, US | 2 |
| Cape Town, ZA | 2 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 2 |
| Shanghai Chenshan Botanical Gardenlocation not on record | 2 |
| Guangzhou, CN | 2 |
| US | 2 |
| BGBMlocation not on record | 2 |
| 河南豫北黄河故道湿地鸟类国家级自然保护区location not on record | 2 |
| Xiamen, CN | 2 |
| KR | 2 |
| USFS/BHSClocation not on record | 2 |
| 盐城国家级珍禽自然保护区location not on record | 2 |
| BISHlocation not on record | 2 |
| Conway, US | 2 |
| Tomioka, JP | 2 |
| State University of New York, College at Oneontalocation not on record | 2 |
| Weymouth Woods Sandhills Nature Preservelocation not on record | 2 |
| Asheville, US | 2 |
| Brookings, US | 2 |
| Henry Brockhouse Collectionlocation not on record | 2 |
| Sapporo, JP | 1 |
| Cochabamba, BO | 1 |
| Valparaiso, CL | 1 |
| Turlock, US | 1 |
| McGill University, Herbariumlocation not on record | 1 |
| Yaoundé, CM | 1 |
| Nagatoro-machi, Chichibu-gun, JP | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| Monastir, TN | 1 |
| Oakland University Herbariumlocation not on record | 1 |
| Montréal, CA | 1 |
| INFlocation not on record | 1 |
| Taipei, TW | 1 |
| Elikins, US | 1 |
| Antiguo Cuscatlán, SV | 1 |
| PRClocation not on record | 1 |
| Yerevan, AM | 1 |
| Zhuzhou, CN | 1 |
| Shanghai, CN | 1 |
| BAYLUlocation not on record | 1 |
| Viña del Mar, CL | 1 |
| Anchorage, US | 1 |
| Brown Universitylocation not on record | 1 |
| Herbarium of South China Botanical Gardenlocation not on record | 1 |
| La Paz, BO | 1 |
| Universidade Federal de Santa Catarinalocation not on record | 1 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 1 |
| XAJDlocation not on record | 1 |
| Linares, MX | 1 |
| IPE-CSIClocation not on record | 1 |
| Badajoz, ES | 1 |
| WNNUlocation not on record | 1 |
| Kuopio, FI | 1 |
| Xinxiang, CN | 1 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 1 |
| Edmonton, CA | 1 |
| Tianjin Natural History Museumlocation not on record | 1 |
| Musée des Confluenceslocation not on record | 1 |
| UNINE:NEUlocation not on record | 1 |
| University of British Columbia, Herbariumlocation not on record | 1 |
| Natural History Museum, Tribhuvan Universitylocation not on record | 1 |
| University of Lethbridgelocation not on record | 1 |
| Cuenca, EC | 1 |
| Jiujiang Forestry Institutelocation not on record | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| Minot State Universitylocation not on record | 1 |
| Hamilton, US | 1 |
| Severin-McDaniel Insect Collectionlocation not on record | 1 |
| Santa Cruz, US | 1 |
| Stephenville, US | 1 |
| Bruce Peninsula National Parklocation not on record | 1 |
| Due West, US | 1 |
| Sant Julià de Lòria, AD | 1 |
| Córdoba, ES | 1 |
| Durango, US | 1 |
| University of Alberta Museumslocation not on record | 1 |
| DOI/NPS, Mount Rainier National Parklocation not on record | 1 |
| Henderson, US | 1 |
| Caldwell, US | 1 |
| Shanxi Institute of Biologylocation not on record | 1 |
| University of Genevalocation not on record | 1 |
| ENTClocation not on record | 1 |
| Nishihara, JP | 1 |
| HJAEFlocation not on record | 1 |
| Miami, US | 1 |
| La Trobe Universitylocation not on record | 1 |
| Palmerston, AU | 1 |
| ZRC-SAZUlocation not on record | 1 |
| 1 | |
| ULBF-AGRlocation not on record | 1 |
| Campo Mourão, BR | 1 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 1 |
| Decorah, US | 1 |
| QVMAGlocation not on record | 1 |
| Xinjiang Institute of Ecology and Geography, Chinese Academy of Scienceslocation not on record | 1 |
| Tennessee Technological Universitylocation not on record | 1 |
| UFSClocation not on record | 1 |
| UTFPR-CPlocation not on record | 1 |
| UNESP-FCAlocation not on record | 1 |
| Ojo, NG | 1 |
| Tuxtla Gutiérrez, MX | 1 |
| Durham, US | 1 |
| Parkville, AU | 1 |
| ISAlocation not on record | 1 |
| Fullerton, US | 1 |
| Brussel, BE | 1 |
| Corrientes, AR | 1 |
| utaslocation not on record | 1 |
| Blacksburg, US | 1 |
| J. Rusek Collectionlocation not on record | 1 |
| Jurica-Suchy Nature Museumlocation not on record | 1 |
| Mérida, MX | 1 |
| Laboratorio de Ictiologialocation not on record | 1 |
| UFMSlocation not on record | 1 |
| Urumqi, CN | 1 |
| MKD001location not on record | 1 |
| SVN019location not on record | 1 |
| BIO-UNIPIlocation not on record | 1 |
| Chicago, US | 1 |
| Nishihara, JP | 1 |
| Herbario Universidad de Concepciónlocation not on record | 1 |
| SNSNMClocation not on record | 1 |
| Jishou Universitylocation not on record | 1 |
| Beijing Natural History Museumlocation not on record | 1 |
| Cambridge, US | 1 |
| UoB-IBlocation not on record | 1 |
| AASlocation not on record | 1 |
| ESP010location not on record | 1 |
| Vancouver, CA | 1 |
| Hebei Normal Universitylocation not on record | 1 |
| UFOPlocation not on record | 1 |
503 institutions · 11 484 of 13 062 vouchered records shown · 1 126 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA73 detections
Where the DNA of Daucus carota was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found73
Studies independent surveys5
Countries16
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 73 detections have coordinates
Open the map16 countries0
Dry calcareous grasslandsriparian; granitic: bank of dry seasonal str…Urban parks and large gardenscoastal cliffNeotropic
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median17.2 °C 8.90–22.3
Seasonal swing summer↔winter15.3 °C
Max temp (day)20.9 °C 13.0–25.9
Min temp (night)13.9 °C 5.60–18.0
Precipitation73.0 mm/mo 25.7–116
Air humidity59.3 % 53.5–65.1
Moisture balance-41.5 mm/mo -128–78.3
Vapour deficit804 Pa 537–1,155
Wind speed3.40 m/s 2.60–5.60
Cloud cover40.1 % 34.2–52.5
CHELSA 1981–2010, ~9 km grid, at location & month of 47 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.