Datura stramonium
speciesAt a glance
Occurrence records144 169
Data sources15
Biological traits76
DNA specimens91
eDNA detections63
Sources15 archives
Databases and archives Datura stramonium's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility144 152 records↗
OBISOcean Biodiversity Information System17 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI63 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics91 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources76 traits
Chemical compositionLOTUS · NPASS203 compounds
Occurrence & distributionGBIF · OBIS144 169 records
Environmental DNA1 datasets · 11 countries63 detections
DNA & barcodingBOLD · NCBI91 specimens
Genome at a glanceCCDB · GoaT · NCBI2.4 Gbp
01Narrative
Le Datura officinal, Stramoine ou Stramoine commune (Datura stramonium L.) est une espèce de plantes dicotylédones de la famille des Solanaceae. Ses nombreux noms vernaculaires évoquent la forme de la fleur ou la toxicité de la plante. Son absorption est source d'hallucinations, de comportements anormaux, de confusion mentale, d'amnésie, de délires conduisant parfois au coma puis à un arrêt cardiaque et respiratoire. On la rencontre dans les friches, les champs, sur le bord des routes et parfois jusque dans les jardins publics.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology29
Fruit length45 mm
⚠ sources differ — AusTraits: 45 mm · GIFT: 21.25 mm
Fruit length max45 mm
Fruit length min25 mm
Fruit width25 mm
⚠ sources differ — AusTraits: 25 mm · GIFT: 16.5 mm
Fruit width max40 mm
Fruit width min20 mm
Leaf length350 mm
Leaf length max350 mm
Leaf length min25 mm
Leaf mass663 mg
Leaf size3 162 mm²
⚠ sources differ — TRY: 3 162 mm² · LEDA: 14 740 mm² · GIFT: 14 740 mm²
Leaf width125 mm
⚠ sources differ — AusTraits: 125 mm · GIFT: 115 mm
Leaf width max220 mm
Leaf width min15 mm
Petiole length10 cm
Plant height1.17 m
⚠ sources differ — GIFT: 1.17 m · AusTraits: 1.2 m · LEDA: 1.38 m · TRY: 0.375 m
Plant height generative0.75 m
Plant height max2 m
Plant height min0.15 m
Seed length3.57 mm
⚠ sources differ — TRY: 3.57 mm · AusTraits: 3.5 mm · GIFT: 4 mm
Seed mass7.96 mg
⚠ sources differ — TRY: 7.96 mg · LEDA: 8.73 mg · GIFT: 9.03 mg
Seed mass max32.6 mg
Seed mass min5.06 mg
Seed volume9.2 mm³
Seed volume max9.2 mm³
Seed volume min9.2 mm³
Seed width2.5 mm
Seed width max2.5 mm
Seed width min2.5 mm
Life cycle & reproduction18
Deciduousnessdeciduous
Dispersal typehuman
⚠ sources differ — LEDA: agochor · GIFT: unspecialized
Flower colourwhite
Flower length max95 mm
Flower length min70 mm
Flowering endOct
Flowering startApr
Flowering timeyynnnnnnnnny
Life formannual
Life spanannual
Lifespan years1 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formtherophyte
Reproduction asexualabsent
Seed number475
Self fertilizationpresent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment16
Aquaticterrestrial
Climatesubtropical
Climberself-supporting
Elevation max3 300 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
⚠ sources differ — AusTraits: dry · GIFT: fleshy
Fruit typecapsule
Growth formherb
Habitat GIFTÁrea Antrópica
Leaf compoundnesssimple
Leaf formelliptic
Leaf shapeovate rhomboidal
Mycorrhiza typearbuscular
Succulenceno
Woodinessnon-woody
Physiology & chemistry8
Leaf c405 mg/g
Leaf dry-matter content (LDMC)137 mg/g
Leaf n58.3 mg/g
Leaf p2.56 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Seed longevity index0.5
Specific leaf area (SLA)20.2 mm²/mg
⚠ sources differ — TRY: 20.2 mm²/mg · LEDA: 22.3 mm²/mg · GIFT: 28.3 mm²/mg
Other traits3
Defenseyes
Diaspore typeseed
Seeds per fruit>1000
03Chemical composition203 compounds
Compounds documented for Datura stramonium across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Tropane alkaloids111
Ergostane steroids21
Pyrrolidine alkaloids6
Flavonols6
Acyclic monoterpenoids5
Documented compounds203 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| ((1S,5R)-8-Methyl-8-Azabicyclo(3.2.1)Octan-3-Yl) (2R)-3-Hydroxy-2-Phenylpropanoate | present | NPASS | |
| (1R,2R,3E,6S,9E)-3,9-dimethyl-6-prop-1-en-2-ylcyclodeca-3,9-diene-1,2-diol | present | LOTUS | |
| (1R,2R,4S,5S,7s)-9-Methyl-3-oxa-9-azatricyclo[3.3.1.02,4]non-7-yl 2-Phenylprop-2-enoate | present | LOTUS | |
| (1R,2S,4S,5R,10R,11S,13S,14R,15R,17R,18S)-15-[(1S)-1-[(2R)-4,5-dimethyl-6-oxo-2,3-dihydropyran-2-yl]ethyl]-5,13,17-trihydroxy-10,14-dimethyl-3-oxapentacyclo[9.7.0.02,4.05,10.014,18]octadec-7-en-9-one | present | LOTUS | |
| (1R,5R,8R)-8-[(8S,9S,10R,13S,14S,17R)-10,13-dimethyl-1-oxo-4,7,8,9,11,12,14,15,16,17-decahydrocyclopenta[a]phenanthren-17-yl]-5-methyl-4-methylidene-2,6-dioxabicyclo[3.3.1]nonan-3-one | present | LOTUS | |
| (1R,7S,8R,11R)-7-hydroxy-11-(hydroxymethyl)-15-methyl-12,13-dithia-9,15-diazatetracyclo[9.2.2.01,9.03,8]pentadeca-3,5-diene-10,14-dione | present | NPASS | |
| (1S,2R,7R,9S,10S,11S,12S,15R,16R)-15-[(1S)-1-[(2R)-4,5-dimethyl-6-oxo-2,3-dihydropyran-2-yl]ethyl]-10-hydroxy-2,16-dimethyl-8-oxapentacyclo[9.7.0.02,7.07,9.012,16]octadec-4-ene-3,17-dione | present | LOTUS | |
| (1S,2R,7S,9R,11S,12S,15R,16S)-15-[(1R)-1-[(2R)-4,5-dimethyl-6-oxo-2,3-dihydropyran-2-yl]-2-hydroxyethyl]-2,16-dimethyl-8-oxapentacyclo[9.7.0.02,7.07,9.012,16]octadecan-3-one | present | LOTUS | |
| (1S,2R,7S,9R,11S,12S,15R,16S)-2,16-dimethyl-15-[(1R,4R,5R)-1-methyl-8-methylidene-7-oxo-2,6-dioxabicyclo[3.3.1]nonan-4-yl]-8-oxapentacyclo[9.7.0.02,7.07,9.012,16]octadec-4-en-3-one | present | LOTUS | |
| (1S,2S,4S,5R,10R,11S,13R,14R,15R,18S)-15-[(1S)-1-[(2R)-4,5-dimethyl-6-oxo-2,3-dihydropyran-2-yl]ethyl]-5,13-dihydroxy-10,14-dimethyl-3-oxapentacyclo[9.7.0.02,4.05,10.014,18]octadec-7-en-9-one | present | LOTUS |
05DNA & barcoding91 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Datura stramonium has left across the world's sequence archives.
At a glance
DNA specimens91
Marker genes8
GenBank sequences10
eDNA detections63
Countries13
The DNA barcodea real sequence read deposited for this species
CGCATCGCGTCGCCCCCGCACTCCGCGCCCAAAATCTTGGCCGCGGTTGTGTCGTGGGACGGATATTGGCCTCCCGTGAGCCCCCGAGCC …
Datura stramonium voucher ZX-3947 internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK1★rbcL3★rbcLa★trnL-F★ITS6★ITS2trnH-psbA
animal barcodeplant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Datura stramonium carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size2 386 320 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Datura stramonium2.39 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 24 n = 12
Ploidy2× diploid · measured
Chromosome records24–482n range24median24mode95records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2493×CCDB · ita-fl · CCDB · slov-fl · CCDB · iapt +11
CCDB · ita-fl — PAGNI A.M., CORSI G. - 1979. Cariologia di alcune specie d'interesse officinale della flora italiana.. Atti Soc. Tosc. Sci. Nat. Pisa. Mem., ser. B , 86: 465-473.
CCDB · slov-fl — Májovský J. et al., 1970a: Index of chromosome numbers of Slovakian flora (Part 1). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 16: 1-26.
CCDB · slov-fl — Májovský J. et al., 1976: Index of chromosome numbers of Slovakian flora (Part 5). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 25: 1-18.
CCDB · slov-fl — Murín A., 1997: Karyotaxonomy of some medicinal and aromatic plants. - Thaiszia - J. Bot., Košice 7: 75-88.
CCDB · iapt
CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 155-161. Leal Prez-Chao & al.Lagascalia9(2): 269-272(1980).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3376
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3377
CCDB · fl-europaea — Polya, 1949
CCDB · poland — Skali?ska M., Jankun A., Wcis?o H. et al. 1976. Further studies in chromosome numbers of Polish Angiosperms. Eleventh contribution. Acta Biol. Cracov. Ser. Bot. 19, 107-148.
CCDB · ipcn-api-dl — Chariat-Panahi, M. S., H. Lessani & D. Cartier. 1982. Etude caryologique de quelques espèces de la flore de l'Iran. Rev. Cytol. Biol. Veg. Bot. 5: 189–197.
CCDB · ipcn-api-dl — Palomino, G., R. Viveros & J. R. A. Bye. 1988. Cytology of five Mexican species of Datura L. (Solanaceae). S. W. Naturalist 33: 85–90.
CCDB · ipcn-api-dl — Kiehn, M., E. Vitek, E. Hellmayr, J. Walter, J. Tschenett, C. Justin & M. Mann. 1991. Beiträge zur Flora von Österreich: Chromosomenzählungen. Verh. Zool.-Bot. Ges. Wien 128: 19–39.
CCDB · ipcn-api-dl — Hill, L. M. 1995. IOPB chromosome data 10. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 25: 8–9.
CCDB · ipcn-api-dl — Murín, A. 1997. Karyotaxonomy of some medicinal and aromatic plants. Thaiszia 7: 75–88.
CCDB · ipcn-api-dl — Badr, A., S. F. Khalifa, A. I. Aboel-Atta & M. M. Abou-El-Enain. 1997. Chromosomal criteria and taxonomic relationships in the Solanaceae. Cytologia 62: 103–113.
CCDB · ipcn-api-dl — Dobea, C., M. Kiehn & E. Vitek. 1996. Beiträge zur Gefässpflanzen-Flora von Österreich: Chromosomenzählungen III. Verh. Zool.-Bot. Ges. Wien 133: 301–318.
CCDB · ipcn-api-dl — Bir, S. S., S. Kumari, S. P. Shoree & M. S. Sagoo. 1978a. Cytological studies in certain Bicarpeilatse from north and central India. J. Cytol. Genet. 13: 99–106.
CCDB · ipcn-api-dl — Leal Perez-chao, J., A. O. Valbuena, S. P. Sotomayor & M. L. R. Pascual. 1980. In Numeros cromosomicos para la flora Espanola 121-182. Lagascalia 9: 249 –284.
CCDB · ipcn-api-dl — Lessani, H. & S. Chariat-panahi. 1979. In IOPB chromosome number reports LXV. Taxon 28: 635–636.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · ipcn-api-dl — Ge, C. j. & P. Lou. 1990. Cytological study on Datura inermis and D. innoxia. J. Shandong Coll. Traditional Chin. Med. 14: 66–67.
CCDB · book-ipcn67-71 — MAJOVSKY, J., ET. AL. 1970. Index of chromosome numbers of Slovakian flora (Part 1). Acta Fae. Rerum Nat. Univ. Comenianae Bot. 16.: 1-26.
CCDB · book-ipcn67-71 — BAQUAR, S.R. 1967. Cytomorphological studies in the family Solanaceae from West Pakistan. Genetica 38: 388-397
CCDB · book-ipcn75-78 — Skalinska et al. 1976
CCDB · book-ipcn75-78 — Ferakova 1976
CCDB · book-indian_vol1 — Bonicke, L. 1911 ; Belling, J. & Blakeslee, A.F. 1924; Blakeslee, A.F. er al. 1927, 1935, 1937; Lewitsky, G.A. (Fedorov); Blakeslee, A.F. 1931, 1932, 1934 ; Bergner, A.D. & Blakeslee, A.F. 1932 ; Yamamoto, K. & Sakai, K. 1932 ; Bergner, A.D. et al. 1933 ; Tokunaga, K. 1934; Favorski, N.Y. (Fedorov) ; Satina, S. et al. 1941 ; Bergner, A.D. 1943 ; Delay, C. 1947; Satina, S. 1960; Murin (Fedorov); Baquar, S.R. 1967a; Madhavadian, P. 1968 ; Majovsky, J. eta!. 1970a ; Gill, L.S. 1972 ; Lessani, H. & Chariat-Panahi, S. 1979
CCDB · book-indian_vol1 — Blakeslee, A.F. 1928; Kostoff, D. & Kendall, J. (Fedorov); Bergner, A.D. & Blakeslee, A.F. 1932 ; Blakeslee, A.F. et al. 1935, 1937; ,Buchholz, J.T.et at. 1935; Bergner, A.D. 1943 ; belli;Y. C. 1947
CCDB · book-indian_vol1 — Yamamoto, K. & Sakai, K. 1932; Arora, C.lvL 1960
CCDB · book-indian_vol1 — Bonicke, L. 1911; Yamamoto, K. & Sakai, K. 1932; Tokunaga, K. 1934; R udorf, W. & Schwarze, P. 1951
CCDB · book-fedorov — Arora 1960 (I. 1964)
CCDB · book-fedorov — Blakeslee 1928
CCDB · book-fedorov — RocToB, ReH):IaJIJI 1930
CCDB · book-fedorov — Bergner, Blakeslee 1932
CCDB · book-fedorov — Blakeslee et al. ~935, 1937
CCDB · book-fedorov — Buchholz et al. 1935
CCDB · book-fedorov — Bergner 1943
CCDB · book-fedorov — Delay 1947
CCDB · book-fedorov — Yamamoto K., Sakai 1932
CCDB · book-fedorov — Bonicke 1911
+48 more references
2n 482×CCDB · book-indian_vol1 · CCDB · book-fedorov
CCDB · book-indian_vol1 — Belling, J. & Blakeslee, A.F. 1922
CCDB · book-fedorov — Belling, Blakeslee 1922
2n 251×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Fernandes, A. & França, F. (1975). Sur les nombres chromosomiques de quelques plantes du Mozambique. Revista Ci. Biol., Sér. A 7: 83-106.
n 1220×CCDB · iapt · CCDB · solan · CCDB · ipcn-api-dl +2
CCDB · iapt — IAPT/IOPB Chromosome Data 9
CCDB · solan
CCDB · ipcn-api-dl — CHENG, K., Q. Yang & Y. Zheng. 1982. The relation between the patterns of cytomixis and variation of chromosome numbers in pollen mother cells of Jimson weed (Datura stramonium L.). Acta Bot. Sin. 24 (2): 103–108.
CCDB · ipcn-api-dl — Bir, S. S., S. Kumari, S. P. Shoree & M. S. Sagoo. 1978. Cytological studies in certain Bicarpellatae from north and central India. J. Cytol. Genet. 13: 99–106.
CCDB · ipcn-api-dl — Bir, S. S. & Neelam. 1984. SOCGI plant chromosome number reports -- II. J. Cytol. Genet. 19: 113–114.
CCDB · ipcn-api-dl — Husaini, S. W. H. & G. A. Iwo. 1990. Cytomorphological studies in some weedy species of the family Solanaceae from Jos Plateau, Nigeria. Feddes Repert. 101: 41–47.
CCDB · ipcn-api-dl — Bir, S. S., S. Kumari, S. P. Shoree & M. S. Sagoo. 1978a. Cytological studies in certain Bicarpeilatse from north and central India. J. Cytol. Genet. 13: 99–106.
CCDB · ipcn-api-dl — Leal Perez-chao, J., A. O. Valbuena, S. P. Sotomayor & M. L. R. Pascual. 1980. In Numeros cromosomicos para la flora Espanola 121-182. Lagascalia 9: 249 –284.
CCDB · book-ipcn67-71 — MADHAVADIAN, P. 1968. Chromosome numbers in South Indian Solanaceae. Caryologia 21: 343-347.
CCDB · CromoCat 2015 — Bir, S. S. & Neelam. (1984). SOCGI plant chromosome number reports -- II Journal of Cytology and Genetics 19: 113-114
CCDB · CromoCat 2015 — Bir, S. S., Kumari, S., Shore S. P. & Sagoo, M. P. (1978). Cytological studies in certain Bicarpellatae from north and central India. J. Cytol. Genet. 13: 99-106.
CCDB · CromoCat 2015 — Cheng, K., Yang, Q. & Zheng, Y. (1982). The relation between the patterns of cytomixis and variation of chromosome numbers in pollen mother cells of Jimson weed (Datura stramonium L.) Acta Botanica Sinica 24 (2): 103-108
CCDB · CromoCat 2015 — Husaini, S. W. H. & Iwo, G. A. (1990). Cytology of some weedy species of the family Compositae (Asteraceae) from Jos Plateau, Nigeria Feddes Repertorium 101: 49-62
CCDB · CromoCat 2015 — Kaur, D. & Singhal, V. K. (2010). IAPT/IOPB Chromosome Data 9 Taxon 59 (4): 1300-1301
CCDB · CromoCat 2015 — Leal Pérez-Chao, J., Ortiz, A., Pajaron, S. & Rodríguez Pascual, M. L. (1980). Números cromosómicos para la flora española, 155-161. Lagascalia 9(2): 269-272.
CCDB · CromoCat 2015 — Madhavadian, P. (1968). Chromosome numbers in South Indian Solanaceae. Caryologia 21: 343-347.
CCDB · CromoCat 2015 — Vasudevan, K. N. (1975b). Contribution to the cytotaxonomy and cytogeography of the flora of the western Himalayas (with an attempt to compare it with the flora of the Alpes). Part II. Ber. Schweiz. Bot. Ges. (Bull. Soc. Bot. Suisse) 85: 210-252.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelScaffold
Completeness95.2% BUSCO
07Deep time~0.14 Ma lineage
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
DNA clock origin0.14 Ma TimeTree
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.
DNA clock origin
How it livedPBDB
Dietphotoautotroph
08Occurrence & distribution
Record type144 169 records
Wild obs. + sensor135 777
Museum / vouchered7 821
Cultivated / captive33
Other538
Origin
Native75
Introduced4 983
Range
Area of Occupancy AOO275 264 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy61% within 1 km
≤100 m 56 054≤1 km 10 888≤10 km 41 312>10 km 1 282
109 536 georeferenced · 26 241 without coordinates
Open the mapobservation + sensor135 777
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy55% within 1 km
≤100 m 954≤1 km 1 004≤10 km 1 406>10 km 190
3 554 georeferenced · 4 267 without coordinates
Open the institutions mapphysical evidence7 821
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy10% within 1 km
≤1 km 1≤10 km 1>10 km 8
10 georeferenced · 23 without coordinates
Open the mapnot free-living33
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions273 of 522 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Beijing, CN | 325 |
| Durango, MX | 269 |
| MeiseBGlocation not on record | 187 |
| LDlocation not on record | 181 |
| BFLlocation not on record | 178 |
| Saint Louis, US | 176 |
| BIO-UNIPIlocation not on record | 173 |
| Pretoria, ZA | 156 |
| Chengdu, CN | 150 |
| Mexico City, MX | 145 |
| South Kensington, GB | 136 |
| Philadelphia, US | 128 |
| Moscow State Universitylocation not on record | 124 |
| Wuzhou, CN | 112 |
| Uniwersytet Wrocławskilocation not on record | 108 |
| Adelaide, AU | 107 |
| Olocation not on record | 103 |
| Bronx, US | 96 |
| Paris, FR | 88 |
| Yangling, CN | 88 |
| Museo Entomologico de Leonlocation not on record | 86 |
| Berlin, DE | 86 |
| BRNUlocation not on record | 77 |
| Kunming, CN | 76 |
| Uniwersytet Warszawskilocation not on record | 75 |
| Chongqing Museumlocation not on record | 75 |
| Nanjing, CN | 74 |
| Uppsala, SE | 68 |
| University of Stellenboschlocation not on record | 65 |
| Canberra, AU | 64 |
| Mount Annan, AU | 62 |
| MAlocation not on record | 60 |
| Bloomington, US | 59 |
| Mexico City, MX | 56 |
| Christchurch, NZ | 55 |
| Kew, GB | 53 |
| Madison, US | 48 |
| Brisbane, AU | 47 |
| Chengdu, CN | 46 |
| Ann Arbor, US | 46 |
| Guangzhou, CN | 45 |
| Williamsburg, US | 44 |
| SLU Artdatabankenlocation not on record | 44 |
| Adam Mickiewicz University in Poznańlocation not on record | 41 |
| Wuhan, CN | 38 |
| Durban, ZA | 37 |
| KMNlocation not on record | 34 |
| BDBClocation not on record | 34 |
| Barcelona, ES | 33 |
| Provincia di Livornolocation not on record | 33 |
| Riverside, US | 32 |
| Bern, CH | 32 |
| Turku, FI | 32 |
| Burlington, US | 31 |
| Corvallis, US | 31 |
| Department of Plant Resources, National Herbarium and Plant Laboratorieslocation not on record | 31 |
| Pullman, US | 30 |
| Salzburg, AT | 29 |
| València, ES | 28 |
| New Haven, US | 27 |
| Xining, CN | 26 |
| Oskarshamn, SE | 26 |
| Ciudad de México, MX | 26 |
| Auckland, NZ | 26 |
| San Francisco, US | 25 |
| Dresden, DE | 24 |
| College Park, US | 22 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 21 |
| Davis, US | 21 |
| Anchorage, US | 21 |
| Claremont, US | 21 |
| Vitoria, ES | 20 |
| Hobart, AU | 20 |
| ASUlocation not on record | 19 |
| Kathmandu, NP | 19 |
| Bangkok, TH | 19 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 18 |
| DBF-NHMDlocation not on record | 18 |
| Chiba, JP | 18 |
| Entomological Society of Latvialocation not on record | 18 |
| College of the Atlantic, Museumlocation not on record | 18 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 17 |
| Puerto Ayora, EC | 17 |
| Austin, US | 17 |
| Chengdu, CN | 17 |
| Salamanca, ES | 16 |
| Görlitz, DE | 16 |
| San Luis Obispo, US | 16 |
| Tlalnepantla, MX | 16 |
| Tartu, EE | 15 |
| BClocation not on record | 15 |
| Philadelphia, US | 15 |
| Chicago, US | 14 |
| Brussel, BE | 14 |
| Juriquilla, MX | 14 |
| Porto Alegre, BR | 14 |
| Bergen, NO | 14 |
| Québec, CA | 13 |
| Puebla, MX | 13 |
| University of New Hampshirelocation not on record | 13 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 13 |
| Canadian Department of Agriculturelocation not on record | 13 |
| Armidale, AU | 13 |
| ESP003location not on record | 13 |
| GJOlocation not on record | 13 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 12 |
| Chadron, US | 12 |
| Natural History Museum Rotterdamlocation not on record | 12 |
| Staten Island, US | 11 |
| Granada, ES | 11 |
| Lanzhou, CN | 11 |
| Oulu, FI | 11 |
| Santa Barbara, US | 11 |
| Guilin, CN | 11 |
| Phyletisches Museum Jenalocation not on record | 11 |
| Institute for Biology of National Academy of Sci.location not on record | 11 |
| Jena Microbial Resource Collectionlocation not on record | 11 |
| Chapel Hill, US | 11 |
| Awka, NG | 11 |
| Cape Town, ZA | 10 |
| Columbia, US | 10 |
| CICYTEXlocation not on record | 10 |
| Jackson, US | 10 |
| Chapingo, MX | 10 |
| Córdoba, ES | 10 |
| Departamento de Sistematica e Ecologialocation not on record | 10 |
| Dekalb, US | 9 |
| Guasave, MX | 9 |
| Guiyang, CN | 9 |
| Córdoba, AR | 9 |
| GMBAlocation not on record | 9 |
| Fort Worth, US | 9 |
| Salvador, BR | 9 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 9 |
| Wlocation not on record | 9 |
| Badajoz, ES | 9 |
| Strecker Museum, Baylor Universitylocation not on record | 9 |
| St. Paul, US | 9 |
| Tampa, US | 8 |
| Austin, US | 8 |
| Laboratorio de Ictiologialocation not on record | 8 |
| Giardini Botanici Hanburylocation not on record | 8 |
| Millersville, US | 8 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 8 |
| Norfolk, US | 8 |
| National Herbarium & Botanic Gardens of Malawilocation not on record | 8 |
| Knoxville, US | 8 |
| Pamplona, ES | 8 |
| Trondheim, NO | 8 |
| Flagstaff, US | 8 |
| Xiamen, CN | 8 |
| UFBAlocation not on record | 8 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 7 |
| WNNUlocation not on record | 7 |
| Sevilla, ES | 7 |
| Rotorua, NZ | 7 |
| Mlocation not on record | 7 |
| Acadia Universitylocation not on record | 7 |
| Université Lavallocation not on record | 7 |
| Xian, CN | 7 |
| Kensington, AU | 7 |
| GAlocation not on record | 7 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 7 |
| Autlán de Navarro, MX | 7 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 7 |
| Frauenfeld, CH | 7 |
| Culiacán, MX | 7 |
| UChlocation not on record | 7 |
| Tilburg, NL | 7 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 6 |
| BAYLUlocation not on record | 6 |
| Madrid, ES | 6 |
| Istituto Agrario Castelnuovolocation not on record | 6 |
| Davenport, US | 6 |
| Zhengzhou, CN | 6 |
| Uniwersytet Śląski w Katowicachlocation not on record | 6 |
| Shanxi Institute of Biologylocation not on record | 6 |
| Pittsburg, US | 6 |
| Cambridge, US | 6 |
| Aarhus, DK | 6 |
| Academy of Sciences of the Republic of Uzbekistanlocation not on record | 6 |
| Clemson, US | 6 |
| John T. Waterhouse Herbariumlocation not on record | 6 |
| University of Johannesburglocation not on record | 6 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 6 |
| Calabar, NG | 6 |
| León, NI | 6 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 6 |
| Tuscaloosa, US | 6 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 5 |
| Seoul, KR | 5 |
| HNBlocation not on record | 5 |
| Springfield, US | 5 |
| Feira de Santana, BR | 5 |
| Parkville, AU | 5 |
| Fulda, DE | 5 |
| Logan, US | 5 |
| Zacatecas, MX | 5 |
| New Brunswick, US | 5 |
| Universidad de Nariño (UdeNar)location not on record | 5 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 5 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 5 |
| Toronto, CA | 5 |
| McWane Science Centerlocation not on record | 5 |
| Museo Achille Folettolocation not on record | 5 |
| Wellington, NZ | 5 |
| SXTCMlocation not on record | 5 |
| Frankfurt am Main | 5 |
| San Angelo, US | 5 |
| LfUlocation not on record | 5 |
| Odawara, JP | 5 |
| Universidad Nacional de Colombia (UNAL)location not on record | 5 |
| Guatemala, GT | 5 |
| Chaguaramas, TT | 5 |
| Lord Fairfax Community Collegelocation not on record | 5 |
| GZUlocation not on record | 5 |
| Universidad de Caldas (UCaldas)location not on record | 5 |
| Batemans Bay, AU | 5 |
| Northridge, US | 5 |
| WTUlocation not on record | 5 |
| Fayetteville, US | 5 |
| UFMGlocation not on record | 5 |
| Mississippi State, US | 5 |
| Porrentruy, CH | 5 |
| Mérida, MX | 5 |
| Palmerston, AU | 4 |
| Changsha, CN | 4 |
| San Jose, US | 4 |
| GB | 4 |
| Alicante, ES | 4 |
| National Biodiversity Institute, Costa Ricalocation not on record | 4 |
| University of Alberta Museumslocation not on record | 4 |
| Tomioka, JP | 4 |
| Masindi, UG | 4 |
| Instituto do Meio Ambientelocation not on record | 4 |
| Guatemala City, GT | 4 |
| Naturalis Biodiversity Centerlocation not on record | 4 |
| Yunnan Universitylocation not on record | 4 |
| Bozeman, US | 4 |
| Forssa, FI | 4 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 4 |
| Ivano-Frankivsk, UA | 4 |
| Universidade Federal de Sergipe (UFS)location not on record | 4 |
| Nijmegen, NL | 4 |
| Edinburgh, GB | 4 |
| Altos de Pipe, VE | 4 |
| Irvine, US | 4 |
| Tapachula, MX | 4 |
| CEPLAClocation not on record | 4 |
| Chicago, US | 4 |
| SZUlocation not on record | 4 |
| KR | 4 |
| Phoenix, US | 4 |
| Kuopio, FI | 4 |
| Yaoundé, CM | 4 |
| Stockholm, SE | 4 |
| Jiangxi College of Educationlocation not on record | 4 |
| China Agricultural Universitylocation not on record | 4 |
| Valparaiso, CL | 4 |
| Pamplona, ES | 3 |
| Porvoo, FI | 3 |
| Stephenville, US | 3 |
| Servico de Microbiologia e Imunologialocation not on record | 3 |
| Valdosta State Universitylocation not on record | 3 |
| Macomb, US | 3 |
| BSBIlocation not on record | 3 |
| QCNElocation not on record | 3 |
| Zürich, CH | 3 |
| TAFORI-LSRClocation not on record | 3 |
| TUR-Alocation not on record | 3 |
| Xian, CN | 3 |
| Miami, US | 3 |
| Chongqing Natural History Museumlocation not on record | 3 |
| Antiguo Cuscatlán, SV | 3 |
| Bourges, FR | 3 |
| Hangzhou, CN | 3 |
| Portland, US | 3 |
| Shanghai, CN | 3 |
| Missoula, US | 3 |
| Göteborg, SE | 3 |
| Nagatoro-machi, Chichibu-gun, JP | 3 |
| Tuxtla Gutiérrez, MX | 3 |
| Bend, US | 3 |
| CNF-UFHBlocation not on record | 3 |
| Winterthur, CH | 3 |
| Saint John, CA | 3 |
| UGentlocation not on record | 3 |
| Universidad Industrial de Santander (UIS)location not on record | 3 |
| Vancouver, CA | 3 |
| Cambridge, US | 3 |
| USP-IBlocation not on record | 3 |
| Washington, US | 3 |
| Boise, US | 3 |
| JBRJlocation not on record | 3 |
| UFERSAlocation not on record | 3 |
| PUC-RSlocation not on record | 3 |
| Fairfax, US | 3 |
| EL PASO, US | 3 |
| San Diego, US | 3 |
| UnBlocation not on record | 2 |
| DOI/NPS, Greenbelt Parklocation not on record | 2 |
| KIRMlocation not on record | 2 |
| Museum of the Rockieslocation not on record | 2 |
| UESBlocation not on record | 2 |
| Uberlândia, BR | 2 |
| Toluca, MX | 2 |
| Portland, US | 2 |
| Los Angeles, US | 2 |
| Tepatitlán de Morelos, MX | 2 |
| Pocatello, US | 2 |
| Universidad de La Salle (La Salle)location not on record | 2 |
| Smithfield, AU | 2 |
| Natural History Museum, Tribhuvan Universitylocation not on record | 2 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 2 |
| Hudson, US | 2 |
| ROM007location not on record | 2 |
| DOI/NPS, Selma to Montgomery National Historic Traillocation not on record | 2 |
| Spearfish, US | 2 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 2 |
| BISHlocation not on record | 2 |
| Finnish Museum of Natural Historylocation not on record | 2 |
| Loja, EC | 2 |
| National Institute of Biological Resourceslocation not on record | 2 |
| AUAlocation not on record | 2 |
| Cenargenlocation not on record | 2 |
| CASlocation not on record | 2 |
| Moscow, US | 2 |
| Orem, US | 2 |
| UTPLlocation not on record | 2 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 2 |
| JBCLMlocation not on record | 2 |
| Inner Mongolia Universitylocation not on record | 2 |
| University of Guelph, OAC Herbariumlocation not on record | 2 |
| Mexico City, MX | 2 |
| MEXUlocation not on record | 2 |
| FUNEDlocation not on record | 2 |
| Guangzhou, CN | 2 |
| Peking Universitylocation not on record | 2 |
| GHPG$location not on record | 2 |
| Instituto de Ecología Aplicada, Universidad Autónoma de Tamaulipaslocation not on record | 2 |
| Wuhan, CN | 2 |
| Sanda, JP | 2 |
| UFRPElocation not on record | 2 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 2 |
| Brasília, BR | 2 |
| Blumenau, BR | 2 |
| Wollongong, AU | 2 |
| Mexico City, MX | 2 |
| Jaén, ES | 2 |
| Tianjin Natural History Museumlocation not on record | 2 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 2 |
| Tallinn, EE | 2 |
| UEMlocation not on record | 2 |
| Whitewater, US | 2 |
| Albuquerque, US | 2 |
| Arcata, US | 2 |
| Namur, BE | 2 |
| Victoria, CA | 2 |
| Universität Göttingenlocation not on record | 2 |
| PRClocation not on record | 2 |
| “Manash Kozybayev North Kazakhstan University" NPLClocation not on record | 2 |
| Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record | 2 |
| PrivatHerblocation not on record | 2 |
| UNICAMPlocation not on record | 2 |
| Helsinki, FI | 2 |
| Honolulu, US | 2 |
| Weymouth Woods Sandhills Nature Preservelocation not on record | 2 |
| Gujarat Biodiversity Gene Banklocation not on record | 2 |
| Jyväskylä, FI | 2 |
| Akita Prefectural Museumlocation not on record | 2 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 2 |
| Central China Normal Universitylocation not on record | 2 |
| UEMAlocation not on record | 2 |
| EMTCMlocation not on record | 2 |
| University of Zhejianglocation not on record | 2 |
| Quito, EC | 2 |
| Kirksville, US | 2 |
| Hebei Normal Universitylocation not on record | 2 |
| Brasília, BR | 2 |
| Alexandria Universitylocation not on record | 1 |
| Santiago de Cali, CO | 1 |
| Richmond, US | 1 |
| H-Wolflocation not on record | 1 |
| NGCPR01145location not on record | 1 |
| NGCPR01144location not on record | 1 |
| University of Hargeisalocation not on record | 1 |
| FLADlocation not on record | 1 |
| Universidad Nacional Agrarialocation not on record | 1 |
| San José, CR | 1 |
| Viña del Mar, CL | 1 |
| Departamento de Geologia, Universidad de Chilelocation not on record | 1 |
| UFPElocation not on record | 1 |
| NO DISPONIBLElocation not on record | 1 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 1 |
| North Carolina Zoological Parklocation not on record | 1 |
| Cusco, PE | 1 |
| UFSJlocation not on record | 1 |
| Jefferson City, US | 1 |
| JBPlocation not on record | 1 |
| Stellenbosch University, DST- NRF Centre of Excellence for Invasion Biologylocation not on record | 1 |
| BGBMlocation not on record | 1 |
| Ciudad de México, MX | 1 |
| Shanxi Universitylocation not on record | 1 |
| Zhejiang Universitylocation not on record | 1 |
| UFOPlocation not on record | 1 |
| Research Center in Biodiversity and Genetic Resourceslocation not on record | 1 |
| OLAlocation not on record | 1 |
| Tamil Nadu Agricultural Universitylocation not on record | 1 |
| Forest Survey and Design Institute, Forestry Administrative Bureau of Daxinganlinglocation not on record | 1 |
| Zapopan, MX | 1 |
| Herbario Universidad de Concepciónlocation not on record | 1 |
| TROMlocation not on record | 1 |
| Instituto de Investigação Científica Tropicallocation not on record | 1 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 1 |
| Santa Cruz de la Sierra, BO | 1 |
| IPE-CSIClocation not on record | 1 |
| Durham, US | 1 |
| NGCPR01146location not on record | 1 |
| Severin-McDaniel Insect Collectionlocation not on record | 1 |
| Santa Cruz, US | 1 |
| CRSN_LWIROlocation not on record | 1 |
| Firenze, IT | 1 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 1 |
| Universidade Federal de Mato Grosso do Sul, Campus do Pantanallocation not on record | 1 |
| Castelar, AR | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| UNIVASFlocation not on record | 1 |
| Smithsonian Institution, National Museum of Natural History, United States National Herbariumlocation not on record | 1 |
| ESP109location not on record | 1 |
| UNEMATlocation not on record | 1 |
| Jataí / Setor Industrial, BR | 1 |
| Minia, EG | 1 |
| ULBF-AGRlocation not on record | 1 |
| Centre National de la Recherche Scientifique et Technologique / Institut de l'environnement et de recherches agricoleslocation not on record | 1 |
| Audubon Society -- Silver Bluff Audubon Center and Sanctuarylocation not on record | 1 |
| Dublin, IE | 1 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 1 |
| UNESClocation not on record | 1 |
| Denver, US | 1 |
| Mérida, MX | 1 |
| Little Rock, US | 1 |
| SNSNMClocation not on record | 1 |
| Karlsruhe, DE | 1 |
| Londrina, BR | 1 |
| Facultad de Zootecnia y Ecología, Universidad Autónoma de Chihuahualocation not on record | 1 |
| Cochabamba, BO | 1 |
| Philadelphia, US | 1 |
| Managua, NI | 1 |
| Johnson City, US | 1 |
| Tall Timbers Research Stationlocation not on record | 1 |
| Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record | 1 |
| Glocation not on record | 1 |
| La Paz, BO | 1 |
| Sociedad para el Estudio de los Recursos Bióticos de Oaxaca, A. C.location not on record | 1 |
| HUAlocation not on record | 1 |
| Sion, CH | 1 |
| James Cook Townsvillelocation not on record | 1 |
| 黔东南州民族医药研究所标本室location not on record | 1 |
| Musée des Confluenceslocation not on record | 1 |
| US | 1 |
| Jardín Botánico de Cartagena "Guillermo Piñeres" (JBC)location not on record | 1 |
| BioFokuslocation not on record | 1 |
| US | 1 |
| Fredericksburg, US | 1 |
| CIBIOlocation not on record | 1 |
| CPATSAlocation not on record | 1 |
| NGCPR01142location not on record | 1 |
| NGCPR01000location not on record | 1 |
| NGCPR01140location not on record | 1 |
| NGCPR01143location not on record | 1 |
| UNISANTAlocation not on record | 1 |
| University of Southern Mississippilocation not on record | 1 |
| San Bernardino, US | 1 |
| RJBJCIlocation not on record | 1 |
| NGCPR01141location not on record | 1 |
| Tromso University Museumlocation not on record | 1 |
| NGCPR01139location not on record | 1 |
| NGCPR01147location not on record | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| Provo, US | 1 |
| Zhuzhou, CN | 1 |
| Sagamihara, JP | 1 |
| Muséum Henri Lecoqlocation not on record | 1 |
| University of Johannesburg, Department of Botany and Plant Biotechnologylocation not on record | 1 |
| BMlocation not on record | 1 |
| Museum Wasmannlocation not on record | 1 |
| Nanchong, CN | 1 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 1 |
| Hunan Geological Museumlocation not on record | 1 |
| Henderson, US | 1 |
| DULlocation not on record | 1 |
| NMWlocation not on record | 1 |
| No collectionlocation not on record | 1 |
| St. Augustine, TT | 1 |
| Montréal, CA | 1 |
| Monastir, TN | 1 |
| Urumqi, CN | 1 |
| Xinjiang Institute of Ecology and Geography, Chinese Academy of Scienceslocation not on record | 1 |
| CJBNlocation not on record | 1 |
| Universidad Pedagógica y Tecnológica de Colombia (UPTC)location not on record | 1 |
| UIBlocation not on record | 1 |
| Beijing Natural History Museumlocation not on record | 1 |
| Cuenca, EC | 1 |
| Shanghai Chenshan Botanical Gardenlocation not on record | 1 |
| Lincoln, US | 1 |
| Nnamdi Azikiwe University Herbarium (NAUH)location not on record | 1 |
| Tula State Universitylocation not on record | 1 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 1 |
| Centro Cultural Santo Domingolocation not on record | 1 |
| ESP010location not on record | 1 |
| NMBU:MINAlocation not on record | 1 |
| Campo Mourão, BR | 1 |
| SIHUlocation not on record | 1 |
| Oswego, US | 1 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 1 |
| Iwate Prefectural Museumlocation not on record | 1 |
| KURAlocation not on record | 1 |
| Due West, US | 1 |
| Mexico City, MX | 1 |
| Chicago, US | 1 |
| UTFPR-CPlocation not on record | 1 |
| Montréal, CA | 1 |
522 institutions · 7 216 of 7 821 vouchered records shown · 549 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA63 detections
Where the DNA of Datura stramonium was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found63
Studies independent surveys1
Countries11
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 63 detections have coordinates
Open the map11 countries0
mulefat scrub, sandy fresh water sedimentNear river edge;Red soilgarden weedFallow LandGarden
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median17.5 °C 10.9–21.9
Seasonal swing summer↔winter13.6 °C
Max temp (day)21.8 °C 13.4–27.8
Min temp (night)13.0 °C 8.80–17.1
Precipitation64.6 mm/mo 7.40–98.1
Air humidity57.7 % 50.8–65.4
Moisture balance-51.1 mm/mo -112–50.5
Vapour deficit851 Pa 473–1,493
Wind speed2.90 m/s 1.80–4.70
Cloud cover28.5 % 10.3–53.0
CHELSA 1981–2010, ~9 km grid, at location & month of 29 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.