Datura metel
speciesAt a glance
Occurrence records2 192
Data sources15
Biological traits51
DNA specimens31
eDNA detections28
Sources15 archives
Databases and archives Datura metel's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility2 187 records↗
OBISOcean Biodiversity Information System5 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI28 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics31 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources51 traits
Chemical compositionLOTUS · NPASS184 compounds
Occurrence & distributionGBIF · OBIS2 192 records
Environmental DNA1 datasets · 2 countries28 detections
DNA & barcodingBOLD · NCBI31 specimens
Genome at a glanceCCDB · GIFT2n = 24
01Narrative
Datura metel est une plante herbacée de la famille des Solanacées. Elle est connue en France métropolitaine sous le nom de métel, à La Réunion d'herbe diable et aux Antilles françaises de gwo konkonb a chyen ou de karapat bata. Synonymes : - (=) Datura alba Nees - (=) Datura chlorantha Hook. - (=) Datura fastuosa L. - (=) Datura metel var. fastuosa (L.) Saff. L'origine du Datura metel est problématique parce que c'est une plante cultivée et sélectionnée par l'homme depuis très longtemps dont aucune forme sauvage n'est connue.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTAusTraitsTRY
Size & morphology19
Fruit length30 mm
Fruit length max30 mm
Fruit length min30 mm
Fruit width35 mm
Leaf length160 mm
⚠ sources differ — AusTraits: 160 mm · GIFT: 125 mm
Leaf length max200 mm
Leaf length min50 mm
Leaf width150 mm
Leaf width max160 mm
Leaf width min30 mm
Plant height1.23 m
⚠ sources differ — GIFT: 1.23 m · AusTraits: 0.75 m
Plant height max2 m
Plant height min0.3 m
Seed length4.5 mm
Seed length max4 mm
Seed mass13.1 mg
⚠ sources differ — TRY: 13.1 mg · GIFT: 11.65 mg
Seed mass max14.1 mg
Seed mass min7.69 mg
Seed width max3 mm
Life cycle & reproduction13
Dehiscencedehiscent
Dispersal typewind
Flower colourpurple
Flowering endOct
Flowering startDec
Flowering timeyynnnnnnnnny
Life formannual
Life spanannual
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formtherophyte
Self fertilizationpresent
Sex typehermaphrodite
Diet & foraging1
Parasiteindependent
Habitat & environment15
Aquaticterrestrial
Climateseasonally dry tropical
Climberself-supporting
Elevation max1 000 m
Elevation mean1 200 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typecapsule
Growth formherb
Habitat GIFTÁrea Antrópica
Leaf compoundnesssimple
Leaf shapeovate widely_ovate
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry2
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Other traits1
Plant support typefree-standing
03Chemical composition184 compounds
Compounds documented for Datura metel across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Ergostane steroids93
Tropane alkaloids41
Germacrane sesquiterpenoids6
Ergostane steroids $ Furostane steroids3
Elemane sesquiterpenoids2
Documented compounds184 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| ((1S,5R)-8-Methyl-8-Azabicyclo(3.2.1)Octan-3-Yl) (2R)-3-Hydroxy-2-Phenylpropanoate | present | NPASS | |
| (10R,13S)-10,13-dimethyl-17-(1-methyl-7,8-dioxo-2,6-dioxabicyclo[3.3.1]nonan-4-yl)-1-oxo-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydrocyclopenta[a]phenanthrene-3-sulfonic acid | present | LOTUS | |
| (10R,13S)-17-[2-hydroxy-1-[5-(methoxymethyl)-4-methyl-6-oxo-2,3-dihydropyran-2-yl]ethyl]-10,13-dimethyl-1-oxo-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydrocyclopenta[a]phenanthrene-3-sulfonic acid | present | LOTUS | |
| (1R,2R,4S,5S,7s)-9-Methyl-3-oxa-9-azatricyclo[3.3.1.02,4]non-7-yl 2-Phenylprop-2-enoate | present | NPASS | |
| (1R,2R,7S,9R,11R,12S,15R,16S,17R)-17-hydroxy-15-[(1R)-2-hydroxy-1-[(2R)-5-(hydroxymethyl)-4-methyl-6-oxo-2,3-dihydropyran-2-yl]ethyl]-2,16-dimethyl-8-oxapentacyclo[9.7.0.02,7.07,9.012,16]octadec-4-en-3-one | present | LOTUS | |
| (1R,2S,4S,5R,10R,11S,13R,14R,15R,17R,18S)-15-[(1R)-1-[(2R)-4,5-dimethyl-6-oxo-2,3-dihydropyran-2-yl]ethyl]-5,13,17-trihydroxy-10,14-dimethyl-3-oxapentacyclo[9.7.0.02,4.05,10.014,18]octadec-7-en-9-one | present | LOTUS | |
| (1R,4R,5R,8R)-8-[(8S,9S,10R,13S,14S,17S)-10,13-dimethyl-1-oxo-4,7,8,9,11,12,14,15,16,17-decahydrocyclopenta[a]phenanthren-17-yl]-4-(methoxymethyl)-5-methyl-2,6-dioxabicyclo[3.3.1]nonan-3-one | present | LOTUS | |
| (1R,4S,5R,8R)-4-(hydroxymethyl)-5-methyl-8-[(5R,6R,8S,9S,10R,12R,13S,14S,17R)-5,6,12-trihydroxy-10,13-dimethyl-1-oxo-6,7,8,9,11,12,14,15,16,17-decahydro-4H-cyclopenta[a]phenanthren-17-yl]-2,6-dioxabicyclo[3.3.1]nonan-3-one | present | LOTUS | |
| (1R,4S,5R,8R)-4-(methoxymethyl)-5-methyl-8-[(5R,6R,8S,9S,10R,12R,13S,14S,17R)-5,6,12-trihydroxy-10,13-dimethyl-1-oxo-6,7,8,9,11,12,14,15,16,17-decahydro-4H-cyclopenta[a]phenanthren-17-yl]-2,6-dioxabicyclo[3.3.1]nonan-3-one | present | LOTUS | |
| (1R,5R,8R)-5-methyl-4-methylidene-8-[(5R,6R,8S,9S,10R,12R,13S,14S,17R)-5,6,12-trihydroxy-10,13-dimethyl-1-oxo-6,7,8,9,11,12,14,15,16,17-decahydro-4H-cyclopenta[a]phenanthren-17-yl]-2,6-dioxabicyclo[3.3.1]nonan-3-one | present | LOTUS |
05DNA & barcoding31 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Datura metel has left across the world's sequence archives.
At a glance
DNA specimens31
Marker genes6
GenBank sequences10
eDNA detections28
Countries2
The DNA barcodea real sequence read deposited for this species
ACGCAGTTGCGCCAAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCGCACTCCGCGCCAAAAACCTTG …
Datura metel 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL5★rbcLa★ITS3★ITS2trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GIFT
The complete instruction manual Datura metel carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 24 n = 12
Ploidy2× diploid · measured
Chromosome records24–482n range24median24mode21records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2419×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-indian_vol1 +3
CCDB · ipcn-api-dl — Bir, S. S. & Neelam. 1984. SOCGI plant chromosome number reports -- II. J. Cytol. Genet. 19: 113–114.
CCDB · ipcn-api-dl — Sinha, A. K. 1991. Biosystematic studies in two species of Datura. Proc. Indian Sci. Congr. Assoc. 78(3,VIII): 83.
CCDB · ipcn-api-dl — Badr, A., S. F. Khalifa, A. I. Aboel-Atta & M. M. Abou-El-Enain. 1997. Chromosomal criteria and taxonomic relationships in the Solanaceae. Cytologia 62: 103–113.
CCDB · book-ipcn67-71 — SIMAK, M. A. GUSTAFSSON, & K. CHING. 1968. Occurence of a mosaic-aneuploid in polyembryonic Norway spruce seed. stud. Forest. suec. 67: 1-8.
CCDB · book-indian_vol1 — Glisic, L.N. 1928 ; Yamamoto, K. & Sakai, K. 1932 ; Blakeslee, A.F. et al. 1935 ; Buchholz, J.T. et al. 1935 ; Delay, C. 1947; Singh, D.N. & Fatima, R. 1966 ; Baquar, S.R. J967a; Simak, M. et al. 1968 ; Chandy, L.P. & Narayanaswamy, S. 1971 ; Gill, L.S. 1972 ; Iyer, R.D. & Raina, S.K. 1972
CCDB · book-indian_vol1 — Yamamoto, K. & Sakai, K. 1932 ; Suzuka, O. & Koriba, S. 1949 (D. 1955)
CCDB · book-indian_vol1 — Vilmorin, R. de & Simonet, M. 1927a, 1928; Bhaduri, P.N. 1933; Bhaduri, P.N. & Sharma, A.K. 1946
CCDB · book-indian_vol1 — Madhavadian, P. 1968
CCDB · book-fedorov — Yamamoto K., Sakai 1932
CCDB · book-fedorov — Suzuka, Koriba 1949
CCDB · book-fedorov — D. 1955)
CCDB · book-fedorov — Glisic 1928 viridi
CCDB · book-fedorov — Yamamoto K., Sakai 1932 ~b~L
CCDB · book-fedorov — Blakeslee et al. 1935
CCDB · book-fedorov — Buchholz et al. 1935
CCDB · book-fedorov — Delay 1947
CCDB · book-atlas-flowering-plants — Suzuka & K. 1949
CCDB · book-atlas-flowering-plants — Vilmorin & S. 1927a
GIFT · GIFT (floras)
2n 482×CCDB · book-indian_vol1 · GIFT · GIFT (floras)
CCDB · book-indian_vol1 — Humphries, C.J. et al. 1978
GIFT · GIFT (floras)
n 1213×CCDB · solan · CCDB · ipcn-api-dl · CCDB · book-ipcn72 +2
CCDB · solan
CCDB · ipcn-api-dl — Bir, S. S., S. Kumari, S. P. Shoree & M. S. Sagoo. 1978. Cytological studies in certain Bicarpellatae from north and central India. J. Cytol. Genet. 13: 99–106.
CCDB · ipcn-api-dl — Bir, S. S. & Neelam. 1984. SOCGI plant chromosome number reports -- II. J. Cytol. Genet. 19: 113–114.
CCDB · ipcn-api-dl — Sinha, A. K. 1991. Biosystematic studies in two species of Datura. Proc. Indian Sci. Congr. Assoc. 78(3,VIII): 83.
CCDB · ipcn-api-dl — Bir, S. S., S. Kumari, S. P. Shoree & M. S. Sagoo. 1978a. Cytological studies in certain Bicarpeilatse from north and central India. J. Cytol. Genet. 13: 99–106.
CCDB · ipcn-api-dl — Trivedi, M. P. & R. N. Trivedi. 1992. Chromosomal behaviour in weeds. Glimpses Cytogenet. India 3: 188–198.
CCDB · book-ipcn72 — GILL, L.S. 1972. Chromosome numbers in West-Himalayan bicarpellate species II. Bull. Torrey Bot. Club 99: 36-38.
CCDB · book-ipcn72 — IYER, R.D., & S.K. RAINA. 1972. The early ontogeny Of embryoids and callus from pollen and subsequent organogenesis in anther culture of Datura metel and rice. Planta 104: 146-156.
CCDB · book-ipcn67-71 — MADHAVADIAN, P. 1968. Chromosome numbers in South Indian Solanaceae. Caryologia 21: 343-347.
CCDB · book-ipcn67-71 — BAQUAR, S.R. 1967. Cytomorphological studies in the family Solanaceae from West Pakistan. Genetica 38: 388-397
CCDB · book-ipcn67-71 — SINGH, D. N., & R. FATIMA. 1966. Chromosome mosaics in Datura metel L. (syn. Datura fastuosa L. l Genet. Iber. 18: 279-zgo:--
CCDB · book-ipcn75-78 — Vasudevan 1975
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GIFT · GIFT (floras)
GIFT · GIFT (floras)
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type2 192 records
Wild obs. + sensor1 181
Museum / vouchered991
Cultivated / captive3
Other17
Origin
Native4
Introduced80
Range
Area of Occupancy AOO5 756 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy70% within 1 km
≤100 m 422≤1 km 207≤10 km 192>10 km 79
900 georeferenced · 281 without coordinates
Open the mapobservation + sensor1 181
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy47% within 1 km
≤100 m 31≤1 km 45≤10 km 79>10 km 7
162 georeferenced · 829 without coordinates
Open the institutions mapphysical evidence991
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 3 records without
Open the mapnot free-living3
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions93 of 171 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Beijing, CN | 53 |
| Guangzhou, CN | 48 |
| Kunming, CN | 45 |
| Guilin, CN | 35 |
| Taipei, TW | 33 |
| Bronx, US | 29 |
| Nanjing, CN | 27 |
| Museo Entomologico de Leonlocation not on record | 25 |
| South Kensington, GB | 25 |
| Department of Plant Resources, National Herbarium and Plant Laboratorieslocation not on record | 24 |
| Saint Louis, US | 19 |
| Kathmandu, NP | 18 |
| HNBlocation not on record | 17 |
| LDlocation not on record | 17 |
| Baroda, IN | 16 |
| Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record | 14 |
| Kensington, AU | 13 |
| Leiden University Medical Centerlocation not on record | 12 |
| Kew, GB | 11 |
| University of Stellenboschlocation not on record | 10 |
| Durango, MX | 10 |
| Durban, ZA | 10 |
| Paris, FR | 9 |
| Christchurch, NZ | 9 |
| Yangling, CN | 9 |
| CNF-UFHBlocation not on record | 8 |
| Yunnan Universitylocation not on record | 8 |
| Chicago, US | 8 |
| Pondicherry, IN | 7 |
| Mexico City, MX | 7 |
| MeiseBGlocation not on record | 7 |
| National Herbarium & Botanic Gardens of Malawilocation not on record | 7 |
| Canberra, AU | 7 |
| SXTCMlocation not on record | 7 |
| Guangzhou, CN | 7 |
| Tokushima, JP | 7 |
| Pretoria, ZA | 7 |
| Smithfield, AU | 6 |
| Mount Annan, AU | 6 |
| Guiyang, CN | 6 |
| sxphclocation not on record | 6 |
| Philadelphia, US | 5 |
| Chengdu, CN | 5 |
| Puerto Ayora, EC | 5 |
| Istituto Agrario Castelnuovolocation not on record | 5 |
| Taipei, TW | 5 |
| Museo Nacional de Costa Rica (MNCR)location not on record | 5 |
| Tampa, US | 5 |
| UNIVASFlocation not on record | 5 |
| FJIDClocation not on record | 5 |
| Dehra Dun, IN | 5 |
| Gujarat Biodiversity Gene Banklocation not on record | 4 |
| National Institute of Biological Resourceslocation not on record | 4 |
| Miami, US | 4 |
| IMMUlocation not on record | 4 |
| Riverside, US | 3 |
| Bangkok, TH | 3 |
| Salvador, BR | 3 |
| TAFORI-LSRClocation not on record | 3 |
| Auckland, NZ | 3 |
| Chaguaramas, TT | 3 |
| BRNUlocation not on record | 3 |
| BISHlocation not on record | 3 |
| Mérida, MX | 3 |
| Honolulu, US | 3 |
| Centre National de la Recherche Scientifique et Technologique / Institut de l'environnement et de recherches agricoleslocation not on record | 3 |
| Universität Göttingenlocation not on record | 3 |
| UFBAlocation not on record | 3 |
| Edinburgh, GB | 3 |
| Fort Worth, US | 3 |
| Antiguo Cuscatlán, SV | 3 |
| Palmerston, AU | 3 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 3 |
| Wuhan, CN | 3 |
| Chongqing Museumlocation not on record | 3 |
| Porto Alegre, BR | 3 |
| Nagano City, JP | 3 |
| Brisbane, AU | 3 |
| TAIElocation not on record | 3 |
| Dresden, DE | 3 |
| Adelaide, AU | 2 |
| Ivano-Frankivsk, UA | 2 |
| Barcelona, ES | 2 |
| CEPLAClocation not on record | 2 |
| Pullman, US | 2 |
| Denver, US | 2 |
| Feira de Santana, BR | 2 |
| Laboratorio de Ictiologialocation not on record | 2 |
| Lanzhou, CN | 2 |
| MAlocation not on record | 2 |
| Departamento de Sistematica e Ecologialocation not on record | 2 |
| Changsha, CN | 2 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 2 |
| SLU Artdatabankenlocation not on record | 2 |
| Bando, JP | 2 |
| WNNUlocation not on record | 2 |
| Natural History Museum, Tribhuvan Universitylocation not on record | 2 |
| Yaoundé, CM | 2 |
| Toyama, JP | 2 |
| Instituto do Meio Ambientelocation not on record | 2 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 2 |
| Corporación Autónoma Regional Para la Defensa de la Meseta de Bucaramanga (CDMB)location not on record | 2 |
| Zhengzhou, CN | 2 |
| HUAlocation not on record | 1 |
| Moscow State Universitylocation not on record | 1 |
| Wuhan, CN | 1 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 1 |
| Vietnam Academy of Science and Technology (VAST)location not on record | 1 |
| La Paz, BO | 1 |
| Universidad Industrial de Santander (UIS)location not on record | 1 |
| Shanghai, CN | 1 |
| Servico de Microbiologia e Imunologialocation not on record | 1 |
| Córdoba, AR | 1 |
| Jataí / Setor Industrial, BR | 1 |
| Universidad de Antioquia (UdeA)location not on record | 1 |
| Tapachula, MX | 1 |
| Columbia, US | 1 |
| College of the Atlantic, Museumlocation not on record | 1 |
| València, ES | 1 |
| Chapel Hill, US | 1 |
| Zhejiang Museum of Natural Historylocation not on record | 1 |
| IPA/SPlocation not on record | 1 |
| 黔东南州民族医药研究所标本室location not on record | 1 |
| Zhuzhou, CN | 1 |
| Tsukuba, JP | 1 |
| KOMlocation not on record | 1 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 1 |
| Museu Paraense Emílio Goeldilocation not on record | 1 |
| Davenport, US | 1 |
| Coimbra, PT | 1 |
| Salzburg, AT | 1 |
| Tartu, EE | 1 |
| UFMGlocation not on record | 1 |
| Bloomington, US | 1 |
| NGCPR01126location not on record | 1 |
| NGCPR01115location not on record | 1 |
| NGCPR01121location not on record | 1 |
| NGCPR01125location not on record | 1 |
| NGCPR01123location not on record | 1 |
| KR | 1 |
| NGCPR01119location not on record | 1 |
| NGCPR01120location not on record | 1 |
| Government College University Lahore, Dr. Sultan Ahmad Herbariumlocation not on record | 1 |
| NGCPR01124location not on record | 1 |
| NGCPR01122location not on record | 1 |
| Monastir, TN | 1 |
| NGCPR01118location not on record | 1 |
| Stockholm, SE | 1 |
| NGCPR01116location not on record | 1 |
| NGCPR01117location not on record | 1 |
| Otaru, JP | 1 |
| Altos de Pipe, VE | 1 |
| Chapingo, MX | 1 |
| “Manash Kozybayev North Kazakhstan University" NPLClocation not on record | 1 |
| Taipei, TW | 1 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 1 |
| Montréal, CA | 1 |
| JBRJlocation not on record | 1 |
| Zhejiang Universitylocation not on record | 1 |
| Wlocation not on record | 1 |
| Hanshan Normal Universitylocation not on record | 1 |
| Xiamen, CN | 1 |
| Albuquerque, US | 1 |
| Paleontological Collectionlocation not on record | 1 |
| Mexico City, MX | 1 |
| HUFDlocation not on record | 1 |
| Chengdu, CN | 1 |
| Nnamdi Azikiwe University Herbarium (NAUH)location not on record | 1 |
| Hobart, AU | 1 |
| Berlin, DE | 1 |
| UnBlocation not on record | 1 |
171 institutions · 904 of 991 vouchered records shown · 82 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA28 detections
Where the DNA of Datura metel was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found28
Studies independent surveys1
Countries2
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 28 detections have coordinates
Open the map2 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median22.0 °C 17.2–25.0
Seasonal swing summer↔winter12.7 °C
Max temp (day)28.7 °C 24.7–29.4
Min temp (night)14.5 °C 10.8–20.8
Precipitation2.30 mm/mo 0.6–174
Air humidity47.4 % 45.0–58.8
Moisture balance-113 mm/mo -126–49.0
Vapour deficit1,147 Pa 1,075–1,465
Wind speed2.60 m/s 2.00–4.60
Cloud cover14.3 % 12.9–18.0
CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.