Dasysyrphus limatus

(Hine, 1922) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Syrphidae/Dasysyrphus

At a glance

Occurrence records48

Data sources7

Biological traits0

DNA specimens41

eDNA detections1

Sources7 archives

Databases and archives Dasysyrphus limatus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility48 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics41 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF48 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD41 specimens

01Narrative

Dasysyrphus limatus is a species of syrphid fly in the family Syrphidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding41 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dasysyrphus limatus has left across the world's sequence archives.

At a glance

DNA specimens41

BINs1

Marker genes1

eDNA detections1

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus35 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

163Avariable

391Cvariable

511Avariable

AACATTATATTTTTTATTTGGAACCTGAGCTGGAATAGTAGGGACATCTCTAAGTGTATTAATTCGTGCAGAACTTGGTCATCCTGGTGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.27%

Haplotypes3

BIN1

Most divergent pair0.76%

N.AmericaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Dasysyrphus intrudenssame genus5.0%Dasysyrphus orsuasame genus5.0%Dasysyrphus amalopissame genus5.3%Dasysyrphus pinastrisame genus5.5%Dasysyrphus pauxillussame genus5.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type48 records

Wild obs. + sensor1

Museum / vouchered47

Range

Area of Occupancy AOO108 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 17≤1 km 5

22 georeferenced · 25 without coordinates

Open the institutions mapphysical evidence47

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Edmonton, CA	22
Toronto, CA	14
University of Guelphlocation not on record	2
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
Canadian National Collection of Insects, Arachnids and Nematodeslocation not on record	1

5 institutions · 40 of 47 vouchered records shown · 7 without an institution code

09Environmental DNA1 detections

Where the DNA of Dasysyrphus limatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median-4.80 °C -4.80–-4.80

Seasonal swing summer↔winter34.1 °C

Max temp (day)-2.00 °C

Min temp (night)-7.80 °C

Precipitation87.0 mm/mo

Air humidity69.7 %

Moisture balance45.9 mm/mo

Vapour deficit204 Pa

Wind speed2.80 m/s

Cloud cover57.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)