Dasymalla terminalis

Endl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Lamiaceae/Dasymalla

At a glance

Occurrence records581

Data sources5

Biological traits18

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Dasymalla terminalis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility581 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources18 traits

Occurrence & distributionGBIF581 records

DNA & barcodingNCBIsequences

01Narrative

Dasymalla terminalis, commonly known as native foxglove, is a flowering plant in the mint family Lamiaceae and is endemic to the south-west of Western Australia. It is a shrub with its branches, leaves and some of its flower parts densely covered with white, woolly hairs. The leaves are thick and soft and the flowers are tube-shaped, pale to deep pinkish-purple or claret red.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology6

Plant height0.65 m

Plant height max1 m

Plant height min0.3 m

Seed mass7.25 mg

⚠ sources differ — TRY: 7.25 mg · AusTraits: 6.18 mg · GIFT: 7.25 mg

Seed mass max7.32 mg

Seed mass min7.17 mg

Life cycle & reproduction4

Deciduousnessevergreen

Life formshrub

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dasymalla terminalis has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSGQ381182.1 ↗578 bp

ACGT

GAAACCCTCAAAGCAGACCGCGAACACGTTATAAACAGCGCACGGCCCGCGGTGCGGCGGGAAACCACCGATCGCGGCGCCACCCCCGCC …

Pityrodia terminalis internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type581 records

Wild obs. + sensor139

Museum / vouchered435

Cultivated / captive7

Origin

Native35

Range

Area of Occupancy AOO1 480 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 64≤1 km 12≤10 km 9>10 km 11

96 georeferenced · 43 without coordinates

Open the mapobservation + sensor139

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy28% within 1 km

≤100 m 66≤1 km 36≤10 km 237>10 km 30

369 georeferenced · 66 without coordinates

Open the institutions mapphysical evidence435

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy86% within 1 km

≤100 m 3≤1 km 3≤10 km 1

7 georeferenced

Open the mapnot free-living7

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	207
Museo Entomologico de Leonlocation not on record	62
Adelaide, AU	56
Canberra, AU	51
Mount Annan, AU	35
Brisbane, AU	8
BGPAlocation not on record	8
Hobart, AU	4
Palmerston, AU	2
Kew, GB	1
Armidale, AU	1

11 institutions · 435 of 435 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)