Dasymalla teckiana

(F.Muell.) B.J.Conn & Henwood · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Lamiaceae/Dasymalla

At a glance

Occurrence records99

Data sources6

Biological traits14

DNA specimens0

eDNA detections1

Sources6 archives

Databases and archives Dasymalla teckiana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility99 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Occurrence & distributionGBIF99 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingNCBIsequences

01Narrative

Dasymalla teckiana is a flowering plant in the mint family Lamiaceae and is endemic to Western Australia. It is a small, openly branched, sticky shrub with mauve and white, bugle-shaped flowers.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFT

Size & morphology4

Plant height0.65 m

Plant height max1 m

Plant height min0.3 m

Seed mass2.53 mg

Life cycle & reproduction3

Life formsubshrub

Life spanperennial

Raunkiær life formchamaephyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dasymalla teckiana has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences3

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSGQ381188.1 ↗538 bp

ACGT

ACCTCCGATCGCGTGCCCACCCCCGCCGGCGCACGCGCGAGCGTGTCGTCGCGCGGGCTAACGAACCCCGGCGCGGCACGCGCCAAGGAA …

Pityrodia teckiana internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type99 records

Wild obs. + sensor8

Museum / vouchered87

Cultivated / captive4

Origin

Native8

Range

Area of Occupancy AOO228 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced · 6 without coordinates

Open the mapobservation + sensor8

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy19% within 1 km

≤100 m 10≤1 km 5≤10 km 57>10 km 7

79 georeferenced · 8 without coordinates

Open the institutions mapphysical evidence87

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 2≤1 km 2

4 georeferenced

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	49
Museo Entomologico de Leonlocation not on record	10
Adelaide, AU	10
Mount Annan, AU	8
Canberra, AU	8
BGPAlocation not on record	2

6 institutions · 87 of 87 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Dasymalla teckiana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)