Dasylirion wheeleri

S.Watson ex Rothr. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Asparagaceae/Dasylirion

At a glance

Occurrence records5 516

Data sources11

Biological traits91

DNA specimens5

eDNA detections5

Sources11 archives

Databases and archives Dasylirion wheeleri's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 516 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources91 traits

Occurrence & distributionGBIF5 516 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceCCDB2n = 38

01Narrative

Dasylirion wheeleri S. Watson ex Rothr. è una pianta angiosperma monocotiledone della famiglia Asparagaceae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTUSDATRY

Size & morphology4

Plant height4.6 m

⚠ sources differ — GIFT: 4.6 m · USDA: 4.57 m · TRY: 4.32 m

Seed mass10.8 mg

⚠ sources differ — TRY: 10.8 mg · GIFT: 7.58 mg

Seed mass max13 mg

Seed mass min1.2 mg

Life cycle & reproduction24

Bloom periodMid Spring

Coppice potentialNo

Flower colourwhite

Flower conspicuousYes

Fruit seed period beginSummer

Fruit seed period endSummer

Growth rate USDASlow

Life formsubshrub or shrub

Life spanperennial

Lifeform raunkiaer detailedchamaephyte

Lifespan categoryLong

Propagated by bare rootYes

Propagated by bulbNo

Propagated by containerYes

Propagated by cormNo

Propagated by cuttingsNo

Propagated by seedYes

Propagated by sodNo

Propagated by sprigsYes

Propagated by tubersNo

Resprout abilityYes

Seed spread rateSlow

Seedling vigorMedium

Vegetative spread rateSlow

Diet & foraging1

Parasiteindependent

Habitat & environment24

Active growth periodSpring and Summer

Adapted to coarse textured soilsYes

Adapted to fine textured soilsNo

Adapted to medium textured soilsYes

Aquaticterrestrial

BloatNone

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Foliage colorDark Green

Foliage porosity summerPorous

Foliage porosity winterPorous

Foliage textureCoarse

Fruit colourbrown

Growth formshrub

Growth form USDASingle Crown

Hedge toleranceNone

Known allelopathNo

Leaf retentionYes

Low growing grassNo

Root depth min24 in

Shape and orientationSemi-Erect

Small grainNo

Woodinesswoody

Physiology & chemistry19

Anaerobic toleranceNone

C:N ratioHigh

Caco3 toleranceMedium

Cold stratification requiredNo

Drought toleranceHigh

Fertility requirementLow

Fire resistantNo

Fire toleranceLow

Frost free days min300 days

Moisture useLow

Nitrogen fixation levelNone

Photosynthetic pathwayC3

Precipitation max14 in

Precipitation min6 in

Salinity toleranceLow

Shade toleranceHigh

Soil pH max9 pH

Soil pH min6.6 pH

Temperature min27 °F

Uses & economy12

Berry nut seed productNo

Christmas tree productNo

Commercial availabilityContracting Only

Fodder productNo

Lumber productNo

Naval store productNo

Nursery stock productNo

Palatable humanYes

Post productNo

Pulpwood productNo

ToxicityNone

Veneer productNo

Other traits7

Fall conspicuousYes

Fruit seed abundanceLow

Fruit seed conspicuousNo

Fruit seed persistenceNo

Height at 20yr3.05 m

Planting density max2 700 per acre

Planting density min1 200 per acre

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dasylirion wheeleri has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes3

GenBank sequences8

eDNA detections5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSU24035.1 ↗230 bp

ACGT

TCACGTCGCTCCGAGCACCCCGCCCCCTGGATCGGGGAGGTGGCGGGCGCGGATCGGAGACTGGCCCCCCGTGCCTTGCGGTGCGGCGGG …

Dasylirion wheeleri 5.8S-26S rDNA internal transcribed spacer 2 (ITS2)

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL3★ITS3

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Dasylirion wheeleri carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 38 n = 19

Ploidydiploid inferred

Chromosome records38–382n range38median38mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 384×CCDB · ipcn-api-dl · CCDB · eflora · CCDB · book-fedorov +1

CCDB · ipcn-api-dl — Johnson, M. A. T. & R. M. O. Gale. 1983. Observations on the leaf-anatomy, pollen, cytology and propagation of Calibanus hookeri (Lem.) Trelease. Bradleya 1: 25–32.

CCDB · eflora

CCDB · book-fedorov — Sato D. 1935b, 1942

CCDB · book-atlas-flowering-plants — AGTV Mexico

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type5 516 records

Wild obs. + sensor5 287

Museum / vouchered225

Cultivated / captive3

Fossil1

Origin

Native9

Range

Area of Occupancy AOO5 356 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 3 880≤1 km 377≤10 km 170>10 km 138

4 565 georeferenced · 722 without coordinates

Open the mapobservation + sensor5 287

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy61% within 1 km

≤100 m 28≤1 km 31≤10 km 34>10 km 3

96 georeferenced · 129 without coordinates

Open the institutions mapphysical evidence225

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions21 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ASUlocation not on record	53
Albuquerque, US	30
Bronx, US	26
EL PASO, US	24
Ann Arbor, US	10
Hermosillo, MX	9
Claremont, US	9
Mexico City, MX	7
Austin, US	7
Riverside, US	7
Chicago, US	6
Flagstaff, US	6
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	5
San Diego, US	4
Zacatecas, MX	3
Provo, US	2
Durango, MX	2
South Kensington, GB	2
Instituto de Ecología, Universidad Nacional Autónoma de Méxicolocation not on record	1
San Luis Obispo, US	1
Austin, US	1
University of Stellenboschlocation not on record	1
Wuzhou, CN	1
New Mexico State Universitylocation not on record	1
Adam Mickiewicz University in Poznańlocation not on record	1
Angwin, US	1
Santa Barbara, US	1

27 institutions · 221 of 225 vouchered records shown · 4 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA5 detections

Where the DNA of Dasylirion wheeleri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median6.40 °C 6.40–6.40

Seasonal swing summer↔winter22.8 °C

Max temp (day)10.1 °C

Min temp (night)1.40 °C

Precipitation151 mm/mo

Air humidity61.0 %

Moisture balance68.1 mm/mo

Vapour deficit376 Pa

Wind speed2.60 m/s

Cloud cover34.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Dasylirion wheeleri

At a glance

Sources11 archives

Size & morphology4

Life cycle & reproduction24

Diet & foraging1

Habitat & environment24

Physiology & chemistry19

Uses & economy12

Other traits7

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type5 516 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions21 of 27 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type5 516 records