Dasylirion texanum

Plantae/Tracheophyta/Liliopsida/Asparagales/Asparagaceae/Dasylirion

At a glance

Occurrence records2 636

Data sources8

Biological traits13

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Dasylirion texanum's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 636 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF2 636 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 38

01Narrative

Dasylirion texanum, the Texas sotol and sotol, is a monocot flowering plant native to central and southwestern Texas and in Coahuila state of northeastern Mexico, including the Chihuahuan Desert.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass5 mg

⚠ sources differ — TRY: 5 mg · GIFT: 8.51 mg

Seed mass max12.02 mg

Seed mass min5 mg

Life cycle & reproduction3

Life formsubshrub

Life spanperennial

Raunkiær life formchamaephyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dasylirion texanum has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSU24034.1 ↗230 bp

ACGT

TCACGTCGCTCCGAGCACCCCGCCCCCTGGATCGGGGAGGTGGCGGGCGCGGATCGGAGACTGGCCCCCCGTGCCTTGCGGTGCGGCGGG …

Dasylirion texanum 5.8S-26S rDNA internal transcribed spacer 2 (ITS2)

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK1rbcL1ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Dasylirion texanum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 38 n = 19

Ploidydiploid inferred

Chromosome records38–382n range38median38mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 382×CCDB · eflora · CCDB · book-atlas-flowering-plants

CCDB · eflora

CCDB · book-atlas-flowering-plants — Sato 1935b

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type2 636 records

Wild obs. + sensor2 516

Museum / vouchered118

Cultivated / captive2

Range

Area of Occupancy AOO3 032 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 1 611≤1 km 262≤10 km 79>10 km 161

2 113 georeferenced · 403 without coordinates

Open the mapobservation + sensor2 516

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy62% within 1 km

≤100 m 27≤1 km 10≤10 km 14>10 km 9

60 georeferenced · 58 without coordinates

Open the institutions mapphysical evidence118

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 1 without coordinates

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions19 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Austin, US	46
Bronx, US	17
Guasave, MX	6
Phoenix, US	5
Mexico City, MX	5
Saint Louis, US	5
Fort Worth, US	5
Chapingo, MX	3
Wuzhou, CN	3
Austin, US	3
ASUlocation not on record	3
South Kensington, GB	3
Mexico City, MX	2
Durango, MX	2
Columbia, US	1
EL PASO, US	1
Linares, MX	1
Clemson, US	1
Bloomington, US	1
Appalachian State Universitylocation not on record	1
Ciudad de México, MX	1
DOI/NPS, Colonial National Historical Parklocation not on record	1

22 institutions · 116 of 118 vouchered records shown · 2 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

At a glance

Sources8 archives

Size & morphology3

Life cycle & reproduction3

Diet & foraging1

Habitat & environment5

Physiology & chemistry1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type2 636 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions19 of 22 geolocated

Cultivated / Captivenot free-living

Record type2 636 records