Dasylirion leiophyllum

Engelm. ex Trel. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Asparagaceae/Dasylirion

At a glance

Occurrence records863

Data sources7

Biological traits14

DNA specimens4

eDNA detections1

Sources7 archives

Databases and archives Dasylirion leiophyllum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility863 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Occurrence & distributionGBIF863 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

سوتل أملس الأوراق هو نوع من النباتات يتبع جنس السوتل من الفصيلة الهليونية.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass8.76 mg

Seed mass max8.76 mg

Seed mass min8.76 mg

Life cycle & reproduction3

Life formsubshrub or shrub

Life spanperennial

Lifeform raunkiaer detailedchamaephyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

⚠ sources differ — GIFT: shrub · TRY: Subshrub, Shrub

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dasylirion leiophyllum has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes5

GenBank sequences5

eDNA detections1

Countries2

The DNA barcodea real sequence read deposited for this species

ITSOL537361.1 ↗356 bpUSA · 2019

ACGT

TGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCATCCGGCCGAGGGCACGCCTGCCTGGGCGTCATGCCTC …

Dasylirion leiophyllum voucher BRIT:Gostel629 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2★ITS1★ITS2trnH-psbA

plant barcodefungal barcodemarker

08Occurrence & distribution

Record type863 records

Wild obs. + sensor723

Museum / vouchered140

Range

Area of Occupancy AOO1 376 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 392≤1 km 72≤10 km 37>10 km 55

556 georeferenced · 167 without coordinates

Open the mapobservation + sensor723

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy72% within 1 km

≤100 m 22≤1 km 9≤10 km 9>10 km 3

43 georeferenced · 97 without coordinates

Open the institutions mapphysical evidence140

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions20 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Austin, US	26
Bronx, US	20
Albuquerque, US	17
Saint Louis, US	13
EL PASO, US	8
University of Stellenboschlocation not on record	8
Phoenix, US	7
Mexico City, MX	6
Austin, US	5
Lubbock, US	5
ASUlocation not on record	3
Riverside, US	3
Fort Worth, US	2
Chicago, US	2
San Angelo, US	2
Ann Arbor, US	2
CASlocation not on record	1
Cambridge, US	1
Facultad de Zootecnia y Ecología, Universidad Autónoma de Chihuahualocation not on record	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Mexico City, MX	1
South Kensington, GB	1
Bloomington, US	1
Madison, US	1
Tampa, US	1

25 institutions · 138 of 140 vouchered records shown · 2 without an institution code

09Environmental DNA1 detections

Where the DNA of Dasylirion leiophyllum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.9 °C 23.9–23.9

Seasonal swing summer↔winter17.6 °C

Max temp (day)29.7 °C

Min temp (night)18.1 °C

Precipitation77.6 mm/mo

Air humidity52.2 %

Moisture balance-96.8 mm/mo

Vapour deficit1,419 Pa

Wind speed2.90 m/s

Cloud cover25.4 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)