Darwinia vestita

(Endl.) Benth. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Darwinia

At a glance

Occurrence records486

Data sources9

Biological traits23

DNA specimens4

eDNA detections4

Sources9 archives

Databases and archives Darwinia vestita's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility486 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources23 traits

Occurrence & distributionGBIF486 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Darwinia vestita, commonly known as the pom-pom darwinia, is a plant in the myrtle family Myrtaceae and is endemic to Western Australia. The shrub has a bushy and erect habit, typically growing to a height of 0.2 to. It blooms between July and December producing white to red or pink flowers. Found on stony hillsides, sandplains, granite outcrops, coastal areas and swamps the species is distributed through a large area along the south coast from the South West to the Goldfields-Esperance region of Western Australia growing in sandy lateritic soils.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology5

Leaf length2.65 mm

Leaf width1.25 mm

Plant height1 m

Plant height max1 m

Plant height min0.2 m

Life cycle & reproduction8

Flowering timennnnnnyyyyyy

Life formshrub

Life spanperennial

Lifespan years6 years

Raunkiær life formphanerophyte

Reproductive maturity3 years

Resprouting capacityfire_killed

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Leaf compoundnesssimple

Leaf shapeovate

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Darwinia vestita has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes2

GenBank sequences6

eDNA detections4

The DNA barcodea real sequence read deposited for this species

ITSKM064840.1 ↗677 bp

ACGT

CTGCGGAAGGATCATTGTCGAGTCCTGCACGGCAGAACGACCAGAGAACACGTTACCAACCGAAAGGGGGACGGCGGGTTCCGCCCGACG …

Darwinia vestita M404 NZFRI 29500 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★ITS3

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Darwinia vestita carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidypolyploid inferred

Chromosome records18–182n range18median18mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 182×CCDB · ipcn-api-dl · CCDB · book-atlas-flowering-plants

CCDB · ipcn-api-dl — Rye, B. L. 1979. Chromosome number variation in the Myrtaceae and its taxonomic implications. Austral. J. Bot. 27: 547–573.

CCDB · book-atlas-flowering-plants

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.980 ↗

08Occurrence & distribution

Record type486 records

Wild obs. + sensor131

Museum / vouchered355

Origin

Native21

Range

Area of Occupancy AOO1 412 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 45≤1 km 29≤10 km 9>10 km 7

90 georeferenced · 41 without coordinates

Open the mapobservation + sensor131

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy23% within 1 km

≤100 m 48≤1 km 16≤10 km 174>10 km 46

284 georeferenced · 71 without coordinates

Open the institutions mapphysical evidence355

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	214
Museo Entomologico de Leonlocation not on record	50
Canberra, AU	29
Adelaide, AU	25
Mount Annan, AU	21
BGPAlocation not on record	10
Brisbane, AU	3
Claremont, US	1
Boise, US	1
Canadian Department of Agriculturelocation not on record	1

10 institutions · 355 of 355 vouchered records shown

09Environmental DNA4 detections

Where the DNA of Darwinia vestita was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)