Darwinia taxifolia

A.Cunn. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Darwinia

At a glance

Occurrence records141

Data sources9

Biological traits18

DNA specimens1

eDNA detections1

Sources9 archives

Databases and archives Darwinia taxifolia's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility141 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources18 traits

Occurrence & distributionGBIF141 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 12

01Narrative

Darwinia taxifolia is a shrub which is endemic to New South Wales in Australia. It has an erect or decumbent habit, growing up to 1 metre high. Pink or purple-red flowers are produced in clusters of 2 to 4 between spring and early summer. The species was first formally described by botanist Allan Cunningham in Geographical Memoirs on New South Wales in 1825, based on plant material collected from rocky areas of the Blue Mountains. There are two subspecies which are currently recognised: D. taxifolia A.Cunn.subsp.taxifolia D. taxifolia subsp. macrolaena B.G.Briggs

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology2

Leaf length8.5 mm

Plant height1 m

Life cycle & reproduction6

Deciduousnessevergreen

Flowering timennnnnnnnyyyy

Life formshrub

Life spanperennial

Raunkiær life formphanerophyte

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Leaf compoundnesssimple

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Darwinia taxifolia has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSKM065060.1 ↗590 bp

ACGT

ACGACCAGAGAACGCGTTACCAACCGAAAAAGGGGGACGGCGGGTTCCGCCCGACGTCCCCCGACGCCTCCGGGCCCGCTCGGGCGCCTC …

Darwinia taxifolia M374 NZFRI 29318 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Darwinia taxifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 12 n = 6

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 62×CCDB · Cave1962

CCDB · Cave1962 — Briggs 1962b

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type141 records

Wild obs. + sensor73

Museum / vouchered67

Other1

Origin

Native28

Range

Area of Occupancy AOO308 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 37≤1 km 7≤10 km 11>10 km 3

58 georeferenced · 15 without coordinates

Open the mapobservation + sensor73

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy27% within 1 km

≤100 m 3≤1 km 11≤10 km 34>10 km 4

52 georeferenced · 15 without coordinates

Open the institutions mapphysical evidence67

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	28
Canberra, AU	10
Museo Entomologico de Leonlocation not on record	8
Armidale, AU	5
Adelaide, AU	4
Hobart, AU	3
Wuzhou, CN	2
Brisbane, AU	2
Rotorua, NZ	2
Stockholm, SE	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1
Batemans Bay, AU	1

12 institutions · 67 of 67 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Darwinia taxifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)