Darwinia purpurea

(Endl.) Benth. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Darwinia

At a glance

Occurrence records160

Data sources7

Biological traits20

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Darwinia purpurea's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility160 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources20 traits

Occurrence & distributionGBIF160 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 14

01Narrative

Darwinia purpurea, commonly known as the rose darwinia, is a plant in the myrtle family Myrtaceae and is endemic to Western Australia. The spreading shrub typically grows to a height of 0.2 to and sometimes to 0.7 m. It blooms between July and December producing clumps of dense red-purple flowers. Often found on undulating plains and amongst granite outcrops in the Wheatbelt region of Western Australia where it grows in sandy or lateritic soils.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology6

Plant height0.3 m

Plant height max0.5 m

Plant height min0.1 m

Seed mass1.85 mg

Seed mass max1.85 mg

Seed mass min1.85 mg

Life cycle & reproduction6

Deciduousnessevergreen

Flowering timennnnnnyyyyyy

Life formshrub

Life spanperennial

Raunkiær life formphanerophyte

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Darwinia purpurea has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

matKMK190410.1 ↗2 489 bp

ACGT

GCGGCTAGCATCTTTTACACATTTATATGAAGTAACGGATTCATTCATACCTTCGGTAGAGTTTGTAAGACCACGACTGATCCTGAAAGG …

Darwinia purpurea tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Darwinia purpurea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 141×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Rye, B. L. 1979. Chromosome number variation in the Myrtaceae and its taxonomic implications. Austral. J. Bot. 27: 547–573.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.953 ↗

08Occurrence & distribution

Record type160 records

Wild obs. + sensor19

Museum / vouchered141

Origin

Native6

Range

Area of Occupancy AOO408 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 8≤1 km 5≤10 km 1

14 georeferenced · 5 without coordinates

Open the mapobservation + sensor19

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy32% within 1 km

≤100 m 19≤1 km 11≤10 km 57>10 km 7

94 georeferenced · 47 without coordinates

Open the institutions mapphysical evidence141

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	77
Canberra, AU	15
Museo Entomologico de Leonlocation not on record	14
BGPAlocation not on record	14
Adelaide, AU	8
Mount Annan, AU	6
Hobart, AU	3
Brisbane, AU	3
Claremont, US	1

9 institutions · 141 of 141 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)