Darwinia masonii

C.A.Gardner · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Darwinia

At a glance

Occurrence records43

Data sources5

Biological traits17

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Darwinia masonii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility43 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources17 traits

Occurrence & distributionGBIF43 records

DNA & barcodingNCBIsequences

01Narrative

Darwinia masonii, commonly known as Mason's darwinia is a plant in the myrtle family Myrtaceae and is endemic to Western Australia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology4

Plant height1.5 m

Plant height max2 m

Plant height min1 m

Seed mass5.21 mg

Life cycle & reproduction5

Flowering timennnnnnyyyyyn

Life formshrub

Life spanperennial

Raunkiær life formphanerophyte

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Darwinia masonii has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences10

The DNA barcodea real sequence read deposited for this species

matKMK190407.1 ↗2 488 bp

ACGT

GCGGCTAGCATCTTTTACACATTTATATGAAGTAACGGATTCATTCATACCTTCGGTAGAGTTTGTAAGACCACGACTGATCCTGAAAGG …

Darwinia masonii haplotype K tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK10

plant barcode

08Occurrence & distribution

Record type43 records

Wild obs. + sensor3

Museum / vouchered36

Cultivated / captive4

Origin

Native1

Range

Area of Occupancy AOO28 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 1>10 km 2

3 georeferenced

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 36

36 georeferenced

Open the institutions mapphysical evidence36

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 4

4 georeferenced

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	27
Museo Entomologico de Leonlocation not on record	2
Canberra, AU	2
BGPAlocation not on record	2
Mount Annan, AU	1
Hobart, AU	1
Adelaide, AU	1

7 institutions · 36 of 36 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)