Darlingia darlingiana

(F.Muell.) L.A.S.Johnson · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Proteales/Proteaceae/Darlingia

At a glance

Occurrence records418

Data sources12

Biological traits39

DNA specimens24

eDNA detections21

Sources12 archives

Databases and archives Darlingia darlingiana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility418 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI21 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics24 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources39 traits

Chemical compositionLOTUS30 compounds

Occurrence & distributionGBIF418 records

Environmental DNA1 datasets · 1 countries21 detections

DNA & barcodingBOLD · NCBI24 specimens

Genome at a glanceCCDB · GoaT1.9 Gbp

01Narrative

Darlingia darlingiana is a rainforest tree of the family Proteaceae from Northern Queensland. It was described by Ferdinand von Mueller in 1865 as Helicia darlingiana.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology16

Fruit length57.5 mm

Fruit width25 mm

Leaf length380 mm

Leaf mass182 mg

Leaf mass per area164 g/m2

Leaf size9 735 mm²

⚠ sources differ — TRY: 9 735 mm² · AusTraits: 6 380 mm²

Leaf width80 mm

Petiole length2.25 cm

Plant height30 m

⚠ sources differ — AusTraits: 30 m · TRY: 23 m

Plant height max20 m

Plant height min15 m

Seed length40 mm

Seed mass200 mg

⚠ sources differ — TRY: 200 mg · AusTraits: 200 mg · GIFT: 167 mg

Seed mass max200 mg

Seed mass min100 mg

Seed width17.5 mm

Life cycle & reproduction8

Deciduousnessevergreen

Dispersal typewind

Flowering timeyynnnnnnyyyy

Life formtree

Life spanperennial

Pollination syndromebee

Resprouting capacityresprouts

Sex typehermaphrodite

Habitat & environment8

Climateseasonally dry tropical

Climberself-supporting

Fruit fleshinessdry

Fruit typefollicle

Growth formtree

Leaf compoundnesssimple

Leaf shapelanceolate linear

Woodinesswoody

Physiology & chemistry6

Leaf n12.38 mg/g

Leaf p0.68 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)6.69 mm²/mg

Wood density660 mg/cm³

Other traits1

Plant support typefree-standing

03Chemical composition30 compounds

Compounds documented for Darlingia darlingiana across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Tropane alkaloids19

Piperidine alkaloids10

Documented compounds30 total

Tissue Source Quantified only

Compound	Amount	Source
(1S,2R,7S,9R)-4,5,12-trimethyl-6-oxa-12-azatricyclo[7.2.1.02,7]dodec-4-en-3-one	present	LOTUS
(1S,9R)-4,5,12-trimethyl-6-oxa-12-azatricyclo[7.2.1.02,7]dodeca-2(7),4-dien-3-one	present	LOTUS
(2R)-1-[(2R)-1-methylpyrrolidin-2-yl]-6-phenylhexan-2-ol	present	LOTUS
(2R,3E,5E)-1-[(2R)-1-methylpyrrolidin-2-yl]-6-phenylhexa-3,5-dien-2-ol	present	LOTUS
(2R,3E,5Z)-1-[(2R)-1-methylpyrrolidin-2-yl]-6-phenylhexa-3,5-dien-2-ol	present	LOTUS
(3E,5E)-1-[(2R)-1-methylpyrrolidin-2-yl]-6-phenylhexa-3,5-dien-2-one	present	LOTUS
(E)-1-[(2R)-1-methylpyrrolidin-2-yl]-4-phenylbut-3-en-2-one	present	LOTUS
(E,2R)-1-[(2R)-1-methylpyrrolidin-2-yl]-4-phenylbut-3-en-2-ol	present	LOTUS
(E,2R)-1-[(2R)-1-methylpyrrolidin-2-yl]-6-phenylhex-5-en-2-ol	present	LOTUS
1-[(1S,5R)-8-methyl-8-azabicyclo[3.2.1]oct-2-en-2-yl]ethanone	present	LOTUS

05DNA & barcoding24 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Darlingia darlingiana has left across the world's sequence archives.

At a glance

DNA specimens24

Marker genes5

GenBank sequences10

eDNA detections21

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKF496617.1 ↗552 bpAustralia · 2013

ACGT

AGTGTCGGATTTAAAGCAGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAAACTAAAGATACGGATATCTTGGCAGCA …

Darlingia darlingiana isolate BATT591-10 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK8★rbcL2★rbcLa★ITStrnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB · GoaT

The complete instruction manual Darlingia darlingiana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 867 980 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Darlingia darlingiana1.87 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidy2× diploid · measured

Chromosome records28–282n range28median28mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 283×GoaT · Kew Plant DNA C-values Database · CCDB · kew · CCDB · Cave1963

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · kew — Jordan GJ, Carpenter RJ, Koutoulis A, Price A, Brodribb TJ. 2014. Environmental adaptation in stomatal size independent of the effects of genome size. New Phytologist 205: 608-617.

CCDB · Cave1963 — Johnson & B. 1963

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type418 records

Wild obs. + sensor58

Museum / vouchered295

Cultivated / captive3

Other62

Origin

Native40

Introduced2

Range

Area of Occupancy AOO852 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 13≤1 km 3≤10 km 2>10 km 1

19 georeferenced · 39 without coordinates

Open the mapobservation + sensor58

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 32≤1 km 33≤10 km 92>10 km 40

197 georeferenced · 98 without coordinates

Open the institutions mapphysical evidence295

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy33% within 1 km

≤1 km 1≤10 km 2

3 georeferenced

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Smithfield, AU	92
Brisbane, AU	70
Mount Annan, AU	43
Museo Entomologico de Leonlocation not on record	33
Canberra, AU	22
James Cook Townsvillelocation not on record	2
Adelaide, AU	2
CSIRO, Tropical Forest Research Centrelocation not on record	1
Kew, GB	1
Armidale, AU	1
University of the Sunshine Coastlocation not on record	1
Australian Tropical Herbariumlocation not on record	1
ASUlocation not on record	1
Palmerston, AU	1

14 institutions · 271 of 295 vouchered records shown · 10 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA21 detections

Where the DNA of Darlingia darlingiana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found21

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 21 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.2 °C 12.2–18.2

Seasonal swing summer↔winter18.4 °C

Max temp (day)18.5 °C 18.5–21.2

Min temp (night)5.80 °C 5.80–14.3

Precipitation10.3 mm/mo 10.3–37.0

Air humidity48.9 % 48.9–62.7

Moisture balance-66.0 mm/mo -68.8–-66.0

Vapour deficit731 Pa 719–744

Wind speed3.40 m/s

Cloud cover8.80 % 8.80–30.2

CHELSA 1981–2010, ~9 km grid, at location & month of 18 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)