Daphniphyllum calycinum

Benth. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Saxifragales/Daphniphyllaceae/Daphniphyllum

At a glance

Occurrence records1 247

Data sources10

Biological traits33

DNA specimens6

eDNA detections3

Sources10 archives

Databases and archives Daphniphyllum calycinum's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 247 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources33 traits

Chemical compositionLOTUS · NPASS141 compounds

Occurrence & distributionGBIF1 247 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI6 specimens

01Narrative

Daphniphyllum calycinum is a species of shrubby plant in the family Daphniphyllaceae. It is found in northern Vietnam and Southeastern Zhōngguó/China. It is used in biodiesel and in lubrication, soap-making and Chinese medicine.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology17

Fruit length7 mm

Fruit length max7 mm

Fruit length min7 mm

Inflorescence length max3 cm

Inflorescence length min2 cm

Leaf length140 mm

Leaf length max160 mm

Leaf length min120 mm

Leaf width65 mm

Leaf width max90 mm

Leaf width min40 mm

Plant height2.75 m

⚠ sources differ — GIFT: 2.75 m · TRY: 6 m

Plant height max4 m

Plant height min1.5 m

Seed mass41.29 mg

Seed mass max41.29 mg

Seed mass min41.29 mg

Life cycle & reproduction5

Deciduousnessevergreen

Dispersal typeanimal

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max1 500 m

Elevation mean875 m

Elevation min250 m

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

03Chemical composition141 compounds

Compounds documented for Daphniphyllum calycinum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Terpenoid alkaloids72

Secokaurane diterpenoids22

Kaurane and Phyllocladane diterpenoids7

Iridoids monoterpenoids $ Terpenoid alkaloids6

Cembrane diterpenoids3

Documented compounds141 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,2S,4R,9R,10S,13R,14R)-14-(hydroxymethyl)-5,5,9-trimethyltetracyclo[11.2.1.01,10.04,9]hexadecane-2,14-diol	present	NPASS
(1R,3E,5S,9R,12S,13E)-12-hydroperoxy-3,12-dimethyl-8-methylidene-6,18-dioxatricyclo[14.2.1.05,9]nonadeca-3,13,16(19)-triene-7,17-dione	present	NPASS
(1R,3E,5S,9R,13R)-13-hydroperoxy-3-methyl-8,12-dimethylidene-6,18-dioxatricyclo[14.2.1.05,9]nonadeca-3,16(19)-diene-7,17-dione	present	NPASS
(1R,3R,4R,10S,14S,15R,18R,19S)-18-(hydroxymethyl)-14-methyl-12-azahexacyclo[10.6.1.11,4.010,18.015,19.07,20]icos-7(20)-ene-3-carboxylic acid	present	LOTUS
(1R,3R,4R,10S,14S,15R,18R,19S)-19-hydroxy-18-(hydroxymethyl)-14-methyl-12-azahexacyclo[10.6.1.11,4.010,18.015,19.07,20]icos-7(20)-ene-3-carboxylic acid	present	LOTUS
(1R,4aR,7aR)-7-(hydroxymethyl)-1-[(2R,3S,4R,5R,6S)-3,4,5-trihydroxy-6-[[(1S,2'R,5R,11S,12S,15S)-2'-methoxy-3-methyl-2'-propan-2-ylspiro[3-azatetracyclo[6.5.1.11,5.011,14]pentadec-8(14)-ene-15,5'-oxane]-12-carbonyl]oxymethyl]oxan-2-yl]oxy-1,4a,5,7a-tetrahydrocyclopenta[c]pyran-4-carboxylic acid	present	LOTUS
(1R,7R,10R,18S,22R,23S)-15-hydroxy-11-methyl-5-oxa-13-azahexacyclo[11.9.1.01,7.07,15.010,23.018,22]tricosan-4-one	present	LOTUS
(1S,1'S,4S,4'S,6S,7'R,8R,9R,10'S,12S,13S,13'S,14'S,15'R,16R,17S,17'S,25'R)-6,9,15'-trihydroxy-7,7,7'-trimethylspiro[3,10-dioxapentacyclo[14.2.1.01,13.04,12.08,12]nonadecane-17,21'-3,9,11,22-tetraoxaheptacyclo[15.6.1.17,10.01,14.04,13.018,23.013,25]pentacos-18(23)-ene]-2,2',18-trione	present	NPASS
(1S,2'R,5R,6S,9R,10R)-2'-(hydroxymethyl)-10-(methoxymethyl)-3',3'-dimethylspiro[3-oxatricyclo[7.2.1.01,6]dodecane-5,1'-cyclohexane]-2,11-dione	present	NPASS
(1S,2'R,5R,6S,9R,10S)-2'-(hydroxymethyl)-10-(methoxymethyl)-3',3'-dimethylspiro[3-oxatricyclo[7.2.1.01,6]dodecane-5,1'-cyclohexane]-2,11-dione	present	NPASS

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Daphniphyllum calycinum has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes3

GenBank sequences8

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPV369036.1 ↗494 bpChina · 2024

ACGT

TGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGC …

Daphniphyllum calycinum voucher MC122 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL2★ITS6

plant barcodefungal barcode

08Occurrence & distribution

Record type1 247 records

Wild obs. + sensor198

Museum / vouchered1 047

Cultivated / captive2

Range

Area of Occupancy AOO1 540 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 100≤1 km 37≤10 km 24>10 km 15

176 georeferenced · 22 without coordinates

Open the mapobservation + sensor198

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 1 045 without coordinates

Open the institutions mapphysical evidence1 047

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions24 of 43 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Guangzhou, CN	252
Guilin, CN	183
Beijing, CN	156
Kunming, CN	82
Guangzhou, CN	74
Nanjing, CN	39
Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record	35
Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record	31
Xiamen, CN	27
Chengdu, CN	14
Hangzhou, CN	14
Zhuzhou, CN	12
Wuhan, CN	10
Shanghai, CN	10
Changsha, CN	9
Yangling, CN	7
Central China Normal Universitylocation not on record	7
Guizhou Forestry Schoollocation not on record	6
Seoul, KR	6
Yunnan Universitylocation not on record	6
Guiyang, CN	6
Nagasaki University - Fisherieslocation not on record	5
Fujian Institute of Subtropical Botanylocation not on record	5
SCAUlocation not on record	5
Paris, FR	5
South China Normal Universitylocation not on record	5
FJFClocation not on record	4
Wuhan, CN	3
San Jose State University, Museum of Birds and Mammalslocation not on record	3
Shanghai, CN	2
South Kensington, GB	2
Xiangtan City, CN	2
Chengdu, CN	2
Guiyang, CN	2
Herbarium of South China Botanical Gardenlocation not on record	2
Guangxi Medicinal Botanic Gardenlocation not on record	2
Zhejiang Universitylocation not on record	1
GZUlocation not on record	1
Guangxi Agricultural Universitylocation not on record	1
University of Stellenboschlocation not on record	1
Saint Louis, US	1
LDlocation not on record	1
Xishuangbanna Tropical Botanical Garden, Academia Sinicalocation not on record	1

43 institutions · 1 042 of 1 047 vouchered records shown · 5 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Daphniphyllum calycinum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.7 °C 24.7–24.7

Seasonal swing summer↔winter18.8 °C

Max temp (day)27.6 °C

Min temp (night)20.2 °C

Precipitation242 mm/mo

Air humidity67.4 %

Moisture balance84.5 mm/mo

Vapour deficit1,017 Pa

Wind speed3.70 m/s

Cloud cover50.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Daphniphyllum calycinum

At a glance

Sources10 archives

Size & morphology17

Life cycle & reproduction5

Diet & foraging1

Habitat & environment9

Physiology & chemistry1

Compound class profile5 classes

Documented compounds141 total

At a glance

Record type1 247 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions24 of 43 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 247 records