Daphne tangutica

Maxim. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malvales/Thymelaeaceae/Daphne

At a glance

Occurrence records758

Data sources10

Biological traits23

DNA specimens3

eDNA detections2

Sources10 archives

Databases and archives Daphne tangutica's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility758 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources23 traits

Chemical compositionLOTUS · NPASS41 compounds

Occurrence & distributionGBIF758 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Daphne tangutica, syn. Daphne retusa, is a species of flowering plant in the family Thymelaeaceae, native to Tibet, China, and possibly Taiwan. It is an evergreen shrub growing to 1 m tall and wide, with leathery leaves and clusters of fragrant white and pink flowers in spring. The flowers are often followed by red berries. The Latin specific epithet tangutica refers to an historical tribe in what is now north western China, but has become a synonym for Tibet, part of the plant's native range. This plant has gained the Royal Horticultural Society's Award of Garden Merit, as has D. tangutica Retusa Group.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology12

Fruit length7 mm

Fruit length max8 mm

Fruit length min6 mm

Leaf length58.75 mm

Leaf length max100 mm

Leaf length min20 mm

Leaf width16 mm

Leaf width max22 mm

Leaf width min5 mm

Plant height1.5 m

⚠ sources differ — GIFT: 1.5 m · TRY: 1.85 m

Plant height max2.5 m

Plant height min0.5 m

Life cycle & reproduction3

Deciduousnessevergreen

Life formsubshrub or shrub

Life spanperennial

Habitat & environment7

Climatetemperate

Climberself-supporting

Elevation max3 800 m

Elevation mean2 400 m

Elevation min1 000 m

Growth formshrub

Woodinesswoody

Other traits1

Plant support typefree-standing

03Chemical composition41 compounds

Compounds documented for Daphne tangutica across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Daphnane diterpenoids7

Furofuranoid lignans7

Simple coumarins7

Coumarinolignans4

Furanoid lignans3

Documented compounds41 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-7-epi-Syringaresinol 4'-glucoside	present	LOTUS
(+)-lariciresinol	present	NPASS
(+)-Pinoresinol	present	LOTUS
(-)-Pinoresinol	present	LOTUS
(2S,3S)-2-(4-hydroxy-3,5-dimethoxyphenyl)-3-(hydroxymethyl)-2,3-dihydropyrano[3,2-h][1,4]benzodioxin-9-one	present	LOTUS
1,5-Dihydroxy-2,3-Dimethoxy-10-Methyl-9-Acridone	present	NPASS
2-(Hydroxymethyl)-6-[3-(3,4,5-trimethoxyphenyl)prop-2-enoxy]oxane-3,4,5-triol	present	LOTUS
2-(Hydroxymethyl)-6-[4-(3-hydroxyprop-1-enyl)-2,6-dimethoxyphenoxy]oxane-3,4,5-triol	present	LOTUS
3-(3-Hydroxy-4-methoxyphenyl)prop-2-enoic acid	present	LOTUS
3-(4-Hydroxy-3,5-dimethoxyphenyl)-2-(hydroxymethyl)-2,3-dihydropyrano[3,2-h][1,4]benzodioxin-9-one	present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Daphne tangutica has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences10

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMW382633.1 ↗634 bp

ACGT

TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAATCCTGCAAAGCAGAACAACCTGTGAACATGTTTACAAATGTGTTGAGGGGGCT …

Daphne tangutica voucher WYJ201807012 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL4★ITS4

plant barcodefungal barcode

08Occurrence & distribution

Record type758 records

Wild obs. + sensor1

Museum / vouchered751

Other6

Range

Area of Occupancy AOO616 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 751 records without

Open the institutions mapphysical evidence751

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions25 of 36 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chengdu, CN	178
Beijing, CN	83
Chengdu, CN	79
Yangling, CN	69
Guangzhou, CN	51
Wuhan, CN	46
Kunming, CN	42
WNNUlocation not on record	40
Nanjing, CN	30
Xining, CN	29
Lanzhou, CN	28
GZFlocation not on record	21
Xian, CN	7
Edinburgh, GB	5
Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record	5
Central China Normal Universitylocation not on record	4
Nanchong, CN	3
Saint Louis, US	3
Guilin, CN	3
“Manash Kozybayev North Kazakhstan University" NPLClocation not on record	2
Chicago, US	2
Zhejiang Universitylocation not on record	2
Seoul, KR	2
Xian, CN	2
Strecker Museum, Baylor Universitylocation not on record	2
Cambridge, US	2
Royal Botanical Gardenslocation not on record	2
Cambridge, US	1
Moscow State Universitylocation not on record	1
Stockholm, SE	1
Chongqing Natural History Museumlocation not on record	1
Adam Mickiewicz University in Poznańlocation not on record	1
Changsha, CN	1
South Kensington, GB	1
Chengdu, CN	1
Philadelphia, US	1

36 institutions · 751 of 751 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Daphne tangutica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)