Daphne striata

Tratt. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malvales/Thymelaeaceae/Daphne

At a glance

Occurrence records8 507

Data sources8

Biological traits25

DNA specimens2

eDNA detections1

Sources8 archives

Databases and archives Daphne striata's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility8 507 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources25 traits

Occurrence & distributionGBIF8 507 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Daphne striata is a shrub, of the family Thymelaeaceae. It is native to the European Alps and the Dolomites.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTLEDATRYWCVP

Size & morphology6

Plant height0.225 m

⚠ sources differ — GIFT: 0.225 m · LEDA: 0.225 m · TRY: 0.062 m

Plant height generative0.225 m

Plant height max0.35 m

Plant height min0.1 m

Seed length5.5 mm

Seed mass19.93 mg

Life cycle & reproduction8

Deciduousnessevergreen

Dispersal typeanimal

Flowering endJul

Flowering startMay

Life formsubshrub

Life spanwoody

⚠ sources differ — TRY: woody · GIFT: perennial

Lifespan years16 years

Raunkiær life formchamaephyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

⚠ sources differ — GIFT: shrub · TRY: shrub (sub-)

Woodinesswoody

Physiology & chemistry3

Leaf dry-matter content (LDMC)290 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)17.62 mm²/mg

Other traits1

Diaspore typefruit

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Daphne striata has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences6

eDNA detections1

Countries3

The DNA barcodea real sequence read deposited for this species

ITSOQ756517.1 ↗425 bpSwitzerland · 1978

ACGT

GTCGAATCCCTGCAAAGCAGAACAACCCGTGAACATGTTTGCAAATGTGTTGAGGGGGCTTGGTGTCATTGGCTTCATCTCCCCTCGACT …

Daphne striata isolate 1E1CR21 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★ITS4

plant barcodefungal barcode

08Occurrence & distribution

Record type8 507 records

Wild obs. + sensor8 252

Museum / vouchered220

Other35

Range

Area of Occupancy AOO6 072 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy23% within 1 km

≤100 m 1 159≤1 km 350≤10 km 5 058>10 km 32

6 599 georeferenced · 1 653 without coordinates

Open the mapobservation + sensor8 252

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤100 m 8≤1 km 24≤10 km 93>10 km 1

126 georeferenced · 94 without coordinates

Open the institutions mapphysical evidence220

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 33 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
BFLlocation not on record	29
GJOlocation not on record	25
Bern, CH	24
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	20
Glarus, CH	14
LDlocation not on record	13
Oskarshamn, SE	12
Salzburg, AT	12
Adam Mickiewicz University in Poznańlocation not on record	12
Institut und Museum fuer Geologie und Palaeontologielocation not on record	6
Wlocation not on record	4
BRNUlocation not on record	4
PRClocation not on record	4
SZUlocation not on record	3
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	3
Zürich, CH	2
Zürich, CH	2
CJBGlocation not on record	2
Bourges, FR	2
Provincia di Livornolocation not on record	2
Dhaka, BD	2
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	2
GZUlocation not on record	2
Helsinki, FI	2
Görlitz, DE	1
LfUlocation not on record	1
Saint Louis, US	1
Auckland, NZ	1
Berlin, DE	1
BIO-UNIPIlocation not on record	1
Logan, US	1
Porrentruy, CH	1
Podgorica, ME	1

33 institutions · 212 of 220 vouchered records shown · 8 without an institution code

09Environmental DNA1 detections

Where the DNA of Daphne striata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Daphne striata

At a glance

Sources8 archives

Size & morphology6

Life cycle & reproduction8

Diet & foraging1

Habitat & environment6

Physiology & chemistry3

Other traits1

At a glance

Record type8 507 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions16 of 33 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type8 507 records