Daphne retusa

Hemsl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malvales/Thymelaeaceae/Daphne

At a glance

Occurrence records499

Data sources8

Biological traits21

DNA specimens1

eDNA detections1

Sources8 archives

Databases and archives Daphne retusa's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility499 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources21 traits

Chemical compositionNPASS7 compounds

Occurrence & distributionGBIF499 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

凹叶瑞香（学名：）为瑞香科瑞香属下的一个种。

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology9

Leaf length27 mm

Leaf length max40 mm

Leaf length min14 mm

Leaf width10 mm

Leaf width max14 mm

Leaf width min6 mm

Plant height0.95 m

⚠ sources differ — GIFT: 0.95 m · TRY: 1.5 m

Plant height max1.5 m

Plant height min0.4 m

Life cycle & reproduction3

Deciduousnessvariable

⚠ sources differ — TRY: deciduous/evergreen · GIFT: evergreen

Life formsubshrub or shrub

Life spanperennial

Habitat & environment8

Climatetemperate

Climberself-supporting

Elevation max4 200 m

Elevation mean3 450 m

Elevation min3 000 m

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

03Chemical composition7 compounds

Compounds documented for Daphne retusa across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Scalarane sesterterpenoids1

Spongiane diterpenoids1

Coumarinolignans1

Documented compounds7 total

Tissue Source Quantified only

Compound	Amount	Source
Daphneticin	present	NPASS
Mooloolabene A	present	NPASS
Mooloolabene B	present	NPASS
Mooloolabene C	present	NPASS
Mooloolabene D	present	NPASS
Mooloolabene E	present	NPASS
Mooloolaldehyde	present	NPASS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Daphne retusa has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences10

eDNA detections1

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMZ578267.1 ↗580 bpIndia

ACGT

TTTACAAATGTGTTGAGGGGGCGTGGTGTCATTGGCTCCATCTCCTCTTGACTGGCCCATGTGGCCAAGATAACCAACCCCGGCACGGAT …

Daphne retusa voucher 23427B internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL4★ITS4

plant barcodefungal barcode

08Occurrence & distribution

Record type499 records

Wild obs. + sensor9

Museum / vouchered487

Cultivated / captive2

Fossil1

Range

Area of Occupancy AOO416 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy33% within 1 km

≤1 km 1≤10 km 2

3 georeferenced · 6 without coordinates

Open the mapobservation + sensor9

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 486 without coordinates

Open the institutions mapphysical evidence487

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 1 without coordinates

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions19 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beijing, CN	140
Yangling, CN	85
Kunming, CN	59
Chengdu, CN	54
Nanjing, CN	44
Chengdu, CN	27
Xining, CN	18
Guangzhou, CN	14
Guilin, CN	9
Chengdu, CN	5
Southwest Forestry Collegelocation not on record	4
Edinburgh, GB	3
Kew, GB	2
Nanchong, CN	2
Lanzhou, CN	2
West China Subalpine Botanical Gardenlocation not on record	2
Central China Normal Universitylocation not on record	2
Strecker Museum, Baylor Universitylocation not on record	2
Yunnan Universitylocation not on record	2
Royal Botanical Gardenslocation not on record	2
Vancouver, CA	1
University of New Hampshirelocation not on record	1
Fujian Institute of Subtropical Botanylocation not on record	1
Xian, CN	1
SABGlocation not on record	1
Seoul, KR	1
Rotorua, NZ	1
University of Stellenboschlocation not on record	1
Fort Worth, US	1

29 institutions · 487 of 487 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Daphne retusa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)