Daphne pseudomezereum

A.Gray · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malvales/Thymelaeaceae/Daphne

At a glance

Occurrence records289

Data sources10

Biological traits26

DNA specimens4

eDNA detections2

Sources10 archives

Databases and archives Daphne pseudomezereum's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility289 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources26 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF289 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Daphne pseudomezereum is a shrub, of the family Thymelaeaceae. It is native to Japan, specifically Honshu, and Korea.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology12

Fruit length5 mm

Fruit length max5 mm

Fruit length min5 mm

Leaf length70 mm

Leaf length max100 mm

Leaf length min40 mm

Leaf width14 mm

Leaf width max20 mm

Leaf width min8 mm

Plant height0.275 m

Plant height max0.4 m

Plant height min0.15 m

Life cycle & reproduction3

Deciduousnessdeciduous

Life formsubshrub or shrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Elevation max1 600 m

Elevation mean1 200 m

Elevation min800 m

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

Physiology & chemistry1

Specific leaf area (SLA)6.18 mm²/mg

03Chemical composition1 compounds

Compounds documented for Daphne pseudomezereum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Furofuranoid lignans1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
(+)-Pinoresinol		present	LOTUS

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Daphne pseudomezereum has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes4

GenBank sequences7

eDNA detections2

Countries2

The DNA barcodea real sequence read deposited for this species

ITSPX056848.1 ↗579 bpSouth Korea · 2025

ACGT

TTTGCAAATGTGTTGAGGGGGGTTGGTGTTATTGGCTCCATCTCTCCTTGACTGGCCCATATGGCCAAAGATAACGAACCCCGGCACGAA …

Daphne pseudomezereum var. koreana isolate Leaf internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL3★ITS2trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Daphne pseudomezereum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 181×CCDB · book-fedorov

CCDB · book-fedorov — Osawa 1913a

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type289 records

Wild obs. + sensor31

Museum / vouchered258

Range

Area of Occupancy AOO796 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy54% within 1 km

≤100 m 8≤1 km 5≤10 km 1>10 km 10

24 georeferenced · 7 without coordinates

Open the mapobservation + sensor31

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 3

3 georeferenced · 255 without coordinates

Open the institutions mapphysical evidence258

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Odawara, JP	108
Chiba, JP	25
Nagano City, JP	24
Tsukuba, JP	23
FFPRIlocation not on record	11
Bando, JP	11
东北师范大学自然博物馆location not on record	9
Sagamihara, JP	9
Northeast Institute of Geography and Agroecology, Chinese Academy of Scienceslocation not on record	7
Museum Of Natural And Environmental History, Shizuokalocation not on record	4
Kochi, JP	4
Fukushima Universitylocation not on record	3
Nishihara, JP	3
Toyama, JP	2
KOMlocation not on record	2
WNNUlocation not on record	2
Forestry and Forest Products Research Institutelocation not on record	2
Chengdu, CN	1
Berlin, DE	1
Parthenon Tama History Museumlocation not on record	1
Sendai, JP	1
Chengdu, CN	1
Burlington, US	1
Sanda, JP	1
Tomioka, JP	1

25 institutions · 257 of 258 vouchered records shown · 1 without an institution code

09Environmental DNA2 detections

Where the DNA of Daphne pseudomezereum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.9 °C 11.3–22.5

Seasonal swing summer↔winter20.3 °C

Max temp (day)19.5 °C 13.9–25.0

Min temp (night)13.3 °C 7.70–18.8

Precipitation273 mm/mo 188–358

Air humidity61.4 % 59.6–63.2

Vapour deficit786 Pa 554–1,018

Cloud cover39.4 % 38.4–40.4

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)