Daphne petraea — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Malvales/Thymelaeaceae/Daphne

At a glance

Occurrence records42

Data sources8

Biological traits9

DNA specimens1

eDNA detections0

Sources8 archives

Databases and archives Daphne petraea's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility42 records↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF42 records

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Daphne petraea is a shrub, of the family Thymelaeaceae. It is endemic to Italy.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology1

Plant height0.06 m

Life cycle & reproduction4

Deciduousnessevergreen

Life formsubshrub

Life spanwoody

Lifespan years10 years

Habitat & environment3

Climatetemperate

Growth formshrub

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Daphne petraea has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOQ756521.1 ↗600 bpItaly · 1957

ACGT

TTGTCGAATCCTGCAAAGCAGAACAACCTGTGAACATGTTTGCAAATGTGTTGAGGGGGCTTGGTGTCATTGGCTCCATCTCCTCTCGAC …

Daphne petraea isolate 11E4SM21 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

rbcL2ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type42 records

Wild obs. + sensor38

Museum / vouchered4

Range

Area of Occupancy AOO96 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 21≤1 km 8≤10 km 1>10 km 1

31 georeferenced · 7 without coordinates

Open the mapobservation + sensor38

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤1 km 1≤10 km 1

2 georeferenced · 2 without coordinates

Open the institutions mapphysical evidence4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Institut und Museum fuer Geologie und Palaeontologielocation not on record	2
Bloomington, US	1
PRClocation not on record	1

3 institutions · 4 of 4 vouchered records shown